FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626120_at:

>probe:Drosophila_2:1626120_at:392:681; Interrogation_Position=1815; Antisense; TATGTCGCTACGTTTATGCAGCCGC
>probe:Drosophila_2:1626120_at:149:353; Interrogation_Position=1832; Antisense; GCAGCCGCCTGGAAATTTTGTGTGA
>probe:Drosophila_2:1626120_at:541:587; Interrogation_Position=1872; Antisense; TGGAGAATGCGGGTGGCCATCTTAC
>probe:Drosophila_2:1626120_at:128:315; Interrogation_Position=1887; Antisense; GCCATCTTACCTGGCGCTTGATTGA
>probe:Drosophila_2:1626120_at:17:345; Interrogation_Position=1902; Antisense; GCTTGATTGATTCCACCAGCCAAAA
>probe:Drosophila_2:1626120_at:483:19; Interrogation_Position=1967; Antisense; ATTTGCCAGGATTCGACTACACTTG
>probe:Drosophila_2:1626120_at:648:161; Interrogation_Position=2004; Antisense; AAATTCTGGAAGTCAGTAGCCCGAC
>probe:Drosophila_2:1626120_at:59:487; Interrogation_Position=2019; Antisense; GTAGCCCGACTCAAAGTATACGAAA
>probe:Drosophila_2:1626120_at:648:165; Interrogation_Position=2075; Antisense; AAATCGCCTATAGACTGTAGCACTA
>probe:Drosophila_2:1626120_at:77:687; Interrogation_Position=2155; Antisense; TTAGGGCTGCCTTGTATTTCAAAAA
>probe:Drosophila_2:1626120_at:158:521; Interrogation_Position=2203; Antisense; GTGGAAACCGAAATGCTTGTGCTCA
>probe:Drosophila_2:1626120_at:337:13; Interrogation_Position=2259; Antisense; ATTAGGTGATCTTAATGCCTGCATA
>probe:Drosophila_2:1626120_at:229:243; Interrogation_Position=2313; Antisense; AATTATTAACTGATTCCGTCCGCAC
>probe:Drosophila_2:1626120_at:585:503; Interrogation_Position=2330; Antisense; GTCCGCACCCTGACAACTGTGTTAA

Paste this into a BLAST search page for me
TATGTCGCTACGTTTATGCAGCCGCGCAGCCGCCTGGAAATTTTGTGTGATGGAGAATGCGGGTGGCCATCTTACGCCATCTTACCTGGCGCTTGATTGAGCTTGATTGATTCCACCAGCCAAAAATTTGCCAGGATTCGACTACACTTGAAATTCTGGAAGTCAGTAGCCCGACGTAGCCCGACTCAAAGTATACGAAAAAATCGCCTATAGACTGTAGCACTATTAGGGCTGCCTTGTATTTCAAAAAGTGGAAACCGAAATGCTTGTGCTCAATTAGGTGATCTTAATGCCTGCATAAATTATTAACTGATTCCGTCCGCACGTCCGCACCCTGACAACTGTGTTAA

Full Affymetrix probeset data:

Annotations for 1626120_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720