Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626123_at:

>probe:Drosophila_2:1626123_at:707:65; Interrogation_Position=13; Antisense; ATGGAATTTCTGGAGAACCTGTACA
>probe:Drosophila_2:1626123_at:707:497; Interrogation_Position=139; Antisense; GTCTTCGTGGCCCTCATCTACATTT
>probe:Drosophila_2:1626123_at:287:39; Interrogation_Position=154; Antisense; ATCTACATTTCGTTCCTGGTGCTAT
>probe:Drosophila_2:1626123_at:327:149; Interrogation_Position=158; Antisense; ACATTTCGTTCCTGGTGCTATTCAT
>probe:Drosophila_2:1626123_at:151:471; Interrogation_Position=165; Antisense; GTTCCTGGTGCTATTCATCTACAAG
>probe:Drosophila_2:1626123_at:678:591; Interrogation_Position=170; Antisense; TGGTGCTATTCATCTACAAGCTGCA
>probe:Drosophila_2:1626123_at:390:423; Interrogation_Position=25; Antisense; GAGAACCTGTACAAAACGCTGCACT
>probe:Drosophila_2:1626123_at:728:599; Interrogation_Position=32; Antisense; TGTACAAAACGCTGCACTCCCTGTT
>probe:Drosophila_2:1626123_at:55:603; Interrogation_Position=53; Antisense; TGTTGTCCTCCTACATCGATCTGGA
>probe:Drosophila_2:1626123_at:132:631; Interrogation_Position=58; Antisense; TCCTCCTACATCGATCTGGACTATT
>probe:Drosophila_2:1626123_at:78:453; Interrogation_Position=70; Antisense; GATCTGGACTATTCGCTATGGCTAT
>probe:Drosophila_2:1626123_at:710:403; Interrogation_Position=76; Antisense; GACTATTCGCTATGGCTATATCGCT
>probe:Drosophila_2:1626123_at:326:9; Interrogation_Position=80; Antisense; ATTCGCTATGGCTATATCGCTTCCT
>probe:Drosophila_2:1626123_at:237:341; Interrogation_Position=84; Antisense; GCTATGGCTATATCGCTTCCTCACC

Paste this into a BLAST search page for me
ATGGAATTTCTGGAGAACCTGTACAGTCTTCGTGGCCCTCATCTACATTTATCTACATTTCGTTCCTGGTGCTATACATTTCGTTCCTGGTGCTATTCATGTTCCTGGTGCTATTCATCTACAAGTGGTGCTATTCATCTACAAGCTGCAGAGAACCTGTACAAAACGCTGCACTTGTACAAAACGCTGCACTCCCTGTTTGTTGTCCTCCTACATCGATCTGGATCCTCCTACATCGATCTGGACTATTGATCTGGACTATTCGCTATGGCTATGACTATTCGCTATGGCTATATCGCTATTCGCTATGGCTATATCGCTTCCTGCTATGGCTATATCGCTTCCTCACC

Full Affymetrix probeset data:

Annotations for 1626123_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime