FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626124_at:

>probe:Drosophila_2:1626124_at:698:495; Interrogation_Position=2226; Antisense; GTCTAGTTCGTAGCTTAGTCTCTGT
>probe:Drosophila_2:1626124_at:112:89; Interrogation_Position=2242; Antisense; AGTCTCTGTCCTAGACCTAGTACTA
>probe:Drosophila_2:1626124_at:526:489; Interrogation_Position=2261; Antisense; GTACTAGCTTAGTCTTGCCACCGAG
>probe:Drosophila_2:1626124_at:713:303; Interrogation_Position=2281; Antisense; CCGAGGCCAGCGACTAAATCTAGAT
>probe:Drosophila_2:1626124_at:169:279; Interrogation_Position=2294; Antisense; CTAAATCTAGATGTGGGCTGCCCAC
>probe:Drosophila_2:1626124_at:576:259; Interrogation_Position=2316; Antisense; CACGCTCATCGCCTTAGTTGAAGGT
>probe:Drosophila_2:1626124_at:120:675; Interrogation_Position=2360; Antisense; TAGCCCAGCTCACCTTAATTAGCAT
>probe:Drosophila_2:1626124_at:342:21; Interrogation_Position=2428; Antisense; ATTTGGCCTCTAACGGCGAAACGCT
>probe:Drosophila_2:1626124_at:226:511; Interrogation_Position=2453; Antisense; GTGAATTCCAGAGTCAGGGCTCCTC
>probe:Drosophila_2:1626124_at:185:461; Interrogation_Position=2486; Antisense; GATTTTGCCGCTGAACATAGTATTA
>probe:Drosophila_2:1626124_at:650:485; Interrogation_Position=2518; Antisense; GTAGCGAACGGCGAGTTTTAGCATA
>probe:Drosophila_2:1626124_at:641:289; Interrogation_Position=2647; Antisense; CGTTGTTACCAACTACTGGCTTTAT
>probe:Drosophila_2:1626124_at:74:641; Interrogation_Position=2724; Antisense; TCTGGGTGTCTTTAATCTCAAACTA
>probe:Drosophila_2:1626124_at:384:15; Interrogation_Position=2756; Antisense; ATTTTATTTGGTGCTTCGTGTGGGA

Paste this into a BLAST search page for me
GTCTAGTTCGTAGCTTAGTCTCTGTAGTCTCTGTCCTAGACCTAGTACTAGTACTAGCTTAGTCTTGCCACCGAGCCGAGGCCAGCGACTAAATCTAGATCTAAATCTAGATGTGGGCTGCCCACCACGCTCATCGCCTTAGTTGAAGGTTAGCCCAGCTCACCTTAATTAGCATATTTGGCCTCTAACGGCGAAACGCTGTGAATTCCAGAGTCAGGGCTCCTCGATTTTGCCGCTGAACATAGTATTAGTAGCGAACGGCGAGTTTTAGCATACGTTGTTACCAACTACTGGCTTTATTCTGGGTGTCTTTAATCTCAAACTAATTTTATTTGGTGCTTCGTGTGGGA

Full Affymetrix probeset data:

Annotations for 1626124_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720