Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626125_at:

>probe:Drosophila_2:1626125_at:597:507; Interrogation_Position=1293; Antisense; GTGCAGAGCAACCATCGAGTGTCCG
>probe:Drosophila_2:1626125_at:676:433; Interrogation_Position=1309; Antisense; GAGTGTCCGGACTGATGCTGGCCAA
>probe:Drosophila_2:1626125_at:471:417; Interrogation_Position=1359; Antisense; GAGCGAGCTCTCAACCAGTATGACA
>probe:Drosophila_2:1626125_at:712:681; Interrogation_Position=1377; Antisense; TATGACAAGCTTCGCAAGCGCGGCG
>probe:Drosophila_2:1626125_at:177:715; Interrogation_Position=1405; Antisense; TTCTTGACCAGTTTCGACGCGAGGA
>probe:Drosophila_2:1626125_at:152:559; Interrogation_Position=1427; Antisense; GGACATCTTCAAGGACGACCTCAAT
>probe:Drosophila_2:1626125_at:702:37; Interrogation_Position=1463; Antisense; ATCTCGCGAAACTGTTGACTGCCTG
>probe:Drosophila_2:1626125_at:149:313; Interrogation_Position=1506; Antisense; GCCACGCGTGAGGACTACATGCAGT
>probe:Drosophila_2:1626125_at:99:229; Interrogation_Position=1548; Antisense; AATGGGCCAGTTGACTCCAAGTCGG
>probe:Drosophila_2:1626125_at:612:543; Interrogation_Position=1574; Antisense; GGATAGTCGATCTGTGACCAGCGCC
>probe:Drosophila_2:1626125_at:656:719; Interrogation_Position=1601; Antisense; TTCCTAGTTCGCTTGTGCCAGAAGA
>probe:Drosophila_2:1626125_at:653:327; Interrogation_Position=1629; Antisense; GCGTGCCATGCATCTTAACCAATGT
>probe:Drosophila_2:1626125_at:514:199; Interrogation_Position=1747; Antisense; AACGCTGTTTCGTCTTTTACGATAT
>probe:Drosophila_2:1626125_at:24:137; Interrogation_Position=1775; Antisense; ACGTTCGTATTTCCATTGTTGCAAA

Paste this into a BLAST search page for me
GTGCAGAGCAACCATCGAGTGTCCGGAGTGTCCGGACTGATGCTGGCCAAGAGCGAGCTCTCAACCAGTATGACATATGACAAGCTTCGCAAGCGCGGCGTTCTTGACCAGTTTCGACGCGAGGAGGACATCTTCAAGGACGACCTCAATATCTCGCGAAACTGTTGACTGCCTGGCCACGCGTGAGGACTACATGCAGTAATGGGCCAGTTGACTCCAAGTCGGGGATAGTCGATCTGTGACCAGCGCCTTCCTAGTTCGCTTGTGCCAGAAGAGCGTGCCATGCATCTTAACCAATGTAACGCTGTTTCGTCTTTTACGATATACGTTCGTATTTCCATTGTTGCAAA

Full Affymetrix probeset data:

Annotations for 1626125_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime