FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626131_at:

>probe:Drosophila_2:1626131_at:12:569; Interrogation_Position=133; Antisense; GGCAGTGCCAAATAATTCTGTTACT
>probe:Drosophila_2:1626131_at:726:181; Interrogation_Position=161; Antisense; AAAACCGAAGAGTTCCTGCTGCAAA
>probe:Drosophila_2:1626131_at:116:183; Interrogation_Position=189; Antisense; AAAATATTCCCTTTGGTCTTCAGAG
>probe:Drosophila_2:1626131_at:110:591; Interrogation_Position=202; Antisense; TGGTCTTCAGAGTATTCCGCATTAC
>probe:Drosophila_2:1626131_at:544:265; Interrogation_Position=290; Antisense; CAGTACTTCAAGCTGAGTCCAGAAA
>probe:Drosophila_2:1626131_at:323:693; Interrogation_Position=322; Antisense; TTTGCAGATGATGCGGTTTCTTATC
>probe:Drosophila_2:1626131_at:608:477; Interrogation_Position=337; Antisense; GTTTCTTATCGAGACCTTTGGCAGA
>probe:Drosophila_2:1626131_at:365:413; Interrogation_Position=349; Antisense; GACCTTTGGCAGATTCATTGGACTC
>probe:Drosophila_2:1626131_at:71:647; Interrogation_Position=363; Antisense; TCATTGGACTCATTACATAGGCGTA
>probe:Drosophila_2:1626131_at:380:71; Interrogation_Position=381; Antisense; AGGCGTAGTATGTTCTTTTTTGATA
>probe:Drosophila_2:1626131_at:121:693; Interrogation_Position=399; Antisense; TTTGATATATTTTCCAGCTGTGAGA
>probe:Drosophila_2:1626131_at:183:109; Interrogation_Position=421; Antisense; AGAAGAATTCCAACGCGCTCATAAA
>probe:Drosophila_2:1626131_at:430:715; Interrogation_Position=69; Antisense; TTCTGCACTTTTTCTTGGGAATCAC
>probe:Drosophila_2:1626131_at:353:527; Interrogation_Position=85; Antisense; GGGAATCACACTCGGAACAGCTATT

Paste this into a BLAST search page for me
GGCAGTGCCAAATAATTCTGTTACTAAAACCGAAGAGTTCCTGCTGCAAAAAAATATTCCCTTTGGTCTTCAGAGTGGTCTTCAGAGTATTCCGCATTACCAGTACTTCAAGCTGAGTCCAGAAATTTGCAGATGATGCGGTTTCTTATCGTTTCTTATCGAGACCTTTGGCAGAGACCTTTGGCAGATTCATTGGACTCTCATTGGACTCATTACATAGGCGTAAGGCGTAGTATGTTCTTTTTTGATATTTGATATATTTTCCAGCTGTGAGAAGAAGAATTCCAACGCGCTCATAAATTCTGCACTTTTTCTTGGGAATCACGGGAATCACACTCGGAACAGCTATT

Full Affymetrix probeset data:

Annotations for 1626131_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720