Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626136_at:

>probe:Drosophila_2:1626136_at:374:171; Interrogation_Position=144; Antisense; AAAGATAAACCCTCAGCACACGATT
>probe:Drosophila_2:1626136_at:525:251; Interrogation_Position=170; Antisense; CAACCCTGGTGGACAATTTATTCGT
>probe:Drosophila_2:1626136_at:123:559; Interrogation_Position=201; Antisense; GGAAACTCGGGCCATTGTTGTCTAC
>probe:Drosophila_2:1626136_at:591:545; Interrogation_Position=246; Antisense; GGATGATTCTCTGTACCCGAAGGAT
>probe:Drosophila_2:1626136_at:703:77; Interrogation_Position=266; Antisense; AGGATCCCCAGAAGCAAGCGCTGAT
>probe:Drosophila_2:1626136_at:170:355; Interrogation_Position=317; Antisense; GCACCCTGTACGATGGCATTGCCAA
>probe:Drosophila_2:1626136_at:191:717; Interrogation_Position=335; Antisense; TTGCCAAGTACTTTTTCCCACTGCT
>probe:Drosophila_2:1626136_at:419:525; Interrogation_Position=366; Antisense; GGGCAAACCCGGAACTCAGGAGAAT
>probe:Drosophila_2:1626136_at:118:609; Interrogation_Position=393; Antisense; TGAGAAACTGAACGCTGCCTTCGAT
>probe:Drosophila_2:1626136_at:448:451; Interrogation_Position=415; Antisense; GATCTTCTCAACAACTTCCTGGATG
>probe:Drosophila_2:1626136_at:168:709; Interrogation_Position=447; Antisense; TTACGTGGCCGGCAATCAGCTTTCA
>probe:Drosophila_2:1626136_at:118:649; Interrogation_Position=462; Antisense; TCAGCTTTCAGTGGCAGATATCGTT
>probe:Drosophila_2:1626136_at:325:459; Interrogation_Position=478; Antisense; GATATCGTTATATTGGCCACCGTTT
>probe:Drosophila_2:1626136_at:66:257; Interrogation_Position=69; Antisense; CAAAGCTGTGGGAGTCGAGTTCAAC

Paste this into a BLAST search page for me
AAAGATAAACCCTCAGCACACGATTCAACCCTGGTGGACAATTTATTCGTGGAAACTCGGGCCATTGTTGTCTACGGATGATTCTCTGTACCCGAAGGATAGGATCCCCAGAAGCAAGCGCTGATGCACCCTGTACGATGGCATTGCCAATTGCCAAGTACTTTTTCCCACTGCTGGGCAAACCCGGAACTCAGGAGAATTGAGAAACTGAACGCTGCCTTCGATGATCTTCTCAACAACTTCCTGGATGTTACGTGGCCGGCAATCAGCTTTCATCAGCTTTCAGTGGCAGATATCGTTGATATCGTTATATTGGCCACCGTTTCAAAGCTGTGGGAGTCGAGTTCAAC

Full Affymetrix probeset data:

Annotations for 1626136_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime