FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626139_at:

>probe:Drosophila_2:1626139_at:48:431; Interrogation_Position=3559; Antisense; GAGTATTACTGTCCCATTCACATGT
>probe:Drosophila_2:1626139_at:702:385; Interrogation_Position=3603; Antisense; GAACACATTTTCTTCGCATATCCTG
>probe:Drosophila_2:1626139_at:644:171; Interrogation_Position=3652; Antisense; AAAGATGCTCCACCGCAGGAAGATT
>probe:Drosophila_2:1626139_at:441:209; Interrogation_Position=3703; Antisense; AAGCAGTTCTGCTTCGATGGCGATC
>probe:Drosophila_2:1626139_at:165:69; Interrogation_Position=3719; Antisense; ATGGCGATCTCCTCACGAAAGGAAA
>probe:Drosophila_2:1626139_at:322:559; Interrogation_Position=3739; Antisense; GGAAACACTTTTGTGGCCCTTCTCT
>probe:Drosophila_2:1626139_at:588:713; Interrogation_Position=3758; Antisense; TTCTCTTGTACACCAGCTTAGCGAA
>probe:Drosophila_2:1626139_at:691:609; Interrogation_Position=3815; Antisense; TGACCTTGCTAGCTGCTCCAAAAAT
>probe:Drosophila_2:1626139_at:137:445; Interrogation_Position=3847; Antisense; GATGATGCATTAGCCGGTGTTTTCT
>probe:Drosophila_2:1626139_at:703:475; Interrogation_Position=3865; Antisense; GTTTTCTTCTGGCTGGTCGGTTGTC
>probe:Drosophila_2:1626139_at:211:45; Interrogation_Position=3891; Antisense; ATCGCGTGCCAAACTTCTTGCCAAG
>probe:Drosophila_2:1626139_at:83:209; Interrogation_Position=3913; Antisense; AAGCTCACAGTCTACGATCCATTCG
>probe:Drosophila_2:1626139_at:214:415; Interrogation_Position=3965; Antisense; GACCACGTGATTTATCTGAGAACCA
>probe:Drosophila_2:1626139_at:490:453; Interrogation_Position=4021; Antisense; GATCATTTGCTTATCAGCGTTCCAC

Paste this into a BLAST search page for me
GAGTATTACTGTCCCATTCACATGTGAACACATTTTCTTCGCATATCCTGAAAGATGCTCCACCGCAGGAAGATTAAGCAGTTCTGCTTCGATGGCGATCATGGCGATCTCCTCACGAAAGGAAAGGAAACACTTTTGTGGCCCTTCTCTTTCTCTTGTACACCAGCTTAGCGAATGACCTTGCTAGCTGCTCCAAAAATGATGATGCATTAGCCGGTGTTTTCTGTTTTCTTCTGGCTGGTCGGTTGTCATCGCGTGCCAAACTTCTTGCCAAGAAGCTCACAGTCTACGATCCATTCGGACCACGTGATTTATCTGAGAACCAGATCATTTGCTTATCAGCGTTCCAC

Full Affymetrix probeset data:

Annotations for 1626139_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720