FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626140_at:

>probe:Drosophila_2:1626140_at:267:675; Interrogation_Position=105; Antisense; TAGCCGACGGCTTATCAACCATTAT
>probe:Drosophila_2:1626140_at:408:419; Interrogation_Position=184; Antisense; GAGTTCCGTCAAAAACGCCGTATTG
>probe:Drosophila_2:1626140_at:81:319; Interrogation_Position=200; Antisense; GCCGTATTGTCCCTACATTTCAAGG
>probe:Drosophila_2:1626140_at:4:491; Interrogation_Position=268; Antisense; GTAAATTCCTATAACTTCGAGCAGA
>probe:Drosophila_2:1626140_at:652:429; Interrogation_Position=331; Antisense; GAGTACCTCAATAAATGCCCACCGG
>probe:Drosophila_2:1626140_at:96:235; Interrogation_Position=344; Antisense; AATGCCCACCGGTCATATATTATGA
>probe:Drosophila_2:1626140_at:549:689; Interrogation_Position=420; Antisense; TATTCCTATTACTTTCTACCACGGG
>probe:Drosophila_2:1626140_at:174:639; Interrogation_Position=522; Antisense; TTTCCTTTCGGACCCATTAATGACG
>probe:Drosophila_2:1626140_at:203:693; Interrogation_Position=555; Antisense; TTTAGGCCCGCAAACTGAAAGTCGT
>probe:Drosophila_2:1626140_at:724:169; Interrogation_Position=572; Antisense; AAAGTCGTGTAGTTCTTGTCTCAAG
>probe:Drosophila_2:1626140_at:145:729; Interrogation_Position=587; Antisense; TTGTCTCAAGGTCCACCCAATGGAG
>probe:Drosophila_2:1626140_at:325:149; Interrogation_Position=612; Antisense; ACTTCGTGATTTTTTGTCTTCGGAG
>probe:Drosophila_2:1626140_at:594:497; Interrogation_Position=627; Antisense; GTCTTCGGAGCTATCCTCAAACATT
>probe:Drosophila_2:1626140_at:282:527; Interrogation_Position=671; Antisense; GGGAATCGCTCATGGCTGACCCGAT

Paste this into a BLAST search page for me
TAGCCGACGGCTTATCAACCATTATGAGTTCCGTCAAAAACGCCGTATTGGCCGTATTGTCCCTACATTTCAAGGGTAAATTCCTATAACTTCGAGCAGAGAGTACCTCAATAAATGCCCACCGGAATGCCCACCGGTCATATATTATGATATTCCTATTACTTTCTACCACGGGTTTCCTTTCGGACCCATTAATGACGTTTAGGCCCGCAAACTGAAAGTCGTAAAGTCGTGTAGTTCTTGTCTCAAGTTGTCTCAAGGTCCACCCAATGGAGACTTCGTGATTTTTTGTCTTCGGAGGTCTTCGGAGCTATCCTCAAACATTGGGAATCGCTCATGGCTGACCCGAT

Full Affymetrix probeset data:

Annotations for 1626140_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720