Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626141_at:

>probe:Drosophila_2:1626141_at:399:425; Interrogation_Position=3991; Antisense; GAGAGTCATTTGTTTATCCTAGAAG
>probe:Drosophila_2:1626141_at:501:173; Interrogation_Position=4025; Antisense; AAAGCAAATGTTCCCTGACCAAGAT
>probe:Drosophila_2:1626141_at:443:429; Interrogation_Position=4059; Antisense; GAGTTCTTCTTTGCAGATGAGTCAA
>probe:Drosophila_2:1626141_at:239:495; Interrogation_Position=4079; Antisense; GTCAAGTCTTGGATCCTGGTCAGAA
>probe:Drosophila_2:1626141_at:286:501; Interrogation_Position=4105; Antisense; GTCGAGCAGGCCACTGAAAGTCCAA
>probe:Drosophila_2:1626141_at:475:221; Interrogation_Position=4128; Antisense; AAGTGTCGATGATATGGCGGCCGAA
>probe:Drosophila_2:1626141_at:577:499; Interrogation_Position=4166; Antisense; GTCTGATGAACTCGCAATTGGCTTA
>probe:Drosophila_2:1626141_at:546:107; Interrogation_Position=4192; Antisense; AGAACATTGAGTTCGCCAGTTGGCG
>probe:Drosophila_2:1626141_at:167:575; Interrogation_Position=4213; Antisense; GGCGGAGTAGTAGACATCCCGAATA
>probe:Drosophila_2:1626141_at:485:609; Interrogation_Position=4298; Antisense; TGAGCTTTCATCCATTGTCCCAGTT
>probe:Drosophila_2:1626141_at:488:361; Interrogation_Position=4345; Antisense; GAAGTAAGGACTCTGCCACAACCTC
>probe:Drosophila_2:1626141_at:603:71; Interrogation_Position=4427; Antisense; AGGCAGGTGATCTGTCAGTGGTTCC
>probe:Drosophila_2:1626141_at:235:471; Interrogation_Position=4462; Antisense; GTTCCTTGCATCAATATCGACCATG
>probe:Drosophila_2:1626141_at:114:471; Interrogation_Position=4502; Antisense; GTTCCTTTGTTAAGCTTGCAGCGCA

Paste this into a BLAST search page for me
GAGAGTCATTTGTTTATCCTAGAAGAAAGCAAATGTTCCCTGACCAAGATGAGTTCTTCTTTGCAGATGAGTCAAGTCAAGTCTTGGATCCTGGTCAGAAGTCGAGCAGGCCACTGAAAGTCCAAAAGTGTCGATGATATGGCGGCCGAAGTCTGATGAACTCGCAATTGGCTTAAGAACATTGAGTTCGCCAGTTGGCGGGCGGAGTAGTAGACATCCCGAATATGAGCTTTCATCCATTGTCCCAGTTGAAGTAAGGACTCTGCCACAACCTCAGGCAGGTGATCTGTCAGTGGTTCCGTTCCTTGCATCAATATCGACCATGGTTCCTTTGTTAAGCTTGCAGCGCA

Full Affymetrix probeset data:

Annotations for 1626141_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime