FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626144_at:

>probe:Drosophila_2:1626144_at:191:713; Interrogation_Position=141; Antisense; TTCGCAACAACTGCTGACACACGGT
>probe:Drosophila_2:1626144_at:13:611; Interrogation_Position=155; Antisense; TGACACACGGTACAGCAATGGGCAG
>probe:Drosophila_2:1626144_at:661:525; Interrogation_Position=213; Antisense; GGGAAGCAAATACTACTACATCGAA
>probe:Drosophila_2:1626144_at:244:339; Interrogation_Position=249; Antisense; GCTAAACTGGCACGATGCTTTGGAT
>probe:Drosophila_2:1626144_at:72:169; Interrogation_Position=284; Antisense; AAATGGGTGGCCATCTGGCCAGTCT
>probe:Drosophila_2:1626144_at:242:581; Interrogation_Position=299; Antisense; TGGCCAGTCTGCAAAGTCAGGAGGA
>probe:Drosophila_2:1626144_at:8:229; Interrogation_Position=349; Antisense; AATGGCCTGAATCGCTACTGGATCG
>probe:Drosophila_2:1626144_at:700:545; Interrogation_Position=368; Antisense; GGATCGACGTGACCAATCAGTTCAA
>probe:Drosophila_2:1626144_at:352:221; Interrogation_Position=396; Antisense; AAGTGAATTCGTTTCTGTGACCAAA
>probe:Drosophila_2:1626144_at:526:511; Interrogation_Position=412; Antisense; GTGACCAAAGGATCGAAGGCCAATT
>probe:Drosophila_2:1626144_at:307:517; Interrogation_Position=479; Antisense; GTGTGGATATCCGAACATTCAATGG
>probe:Drosophila_2:1626144_at:714:455; Interrogation_Position=520; Antisense; GATAACTCATGTTTTGCCAATCTCT
>probe:Drosophila_2:1626144_at:584:311; Interrogation_Position=535; Antisense; GCCAATCTCTATTTTATTTGCGAAA
>probe:Drosophila_2:1626144_at:692:457; Interrogation_Position=617; Antisense; GATATCTGACATTTACCACATGGTT

Paste this into a BLAST search page for me
TTCGCAACAACTGCTGACACACGGTTGACACACGGTACAGCAATGGGCAGGGGAAGCAAATACTACTACATCGAAGCTAAACTGGCACGATGCTTTGGATAAATGGGTGGCCATCTGGCCAGTCTTGGCCAGTCTGCAAAGTCAGGAGGAAATGGCCTGAATCGCTACTGGATCGGGATCGACGTGACCAATCAGTTCAAAAGTGAATTCGTTTCTGTGACCAAAGTGACCAAAGGATCGAAGGCCAATTGTGTGGATATCCGAACATTCAATGGGATAACTCATGTTTTGCCAATCTCTGCCAATCTCTATTTTATTTGCGAAAGATATCTGACATTTACCACATGGTT

Full Affymetrix probeset data:

Annotations for 1626144_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720