Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626146_at:

>probe:Drosophila_2:1626146_at:520:231; Interrogation_Position=123; Antisense; AATGCATGATTTCTGCTGCGACCTG
>probe:Drosophila_2:1626146_at:422:137; Interrogation_Position=152; Antisense; ACGAGAGTCCCCAGTTTAGCGACTG
>probe:Drosophila_2:1626146_at:368:105; Interrogation_Position=227; Antisense; AGACGTACATGTTTTGCACCGCAGA
>probe:Drosophila_2:1626146_at:63:133; Interrogation_Position=244; Antisense; ACCGCAGAGTGCAGTTTCAACAGTA
>probe:Drosophila_2:1626146_at:683:667; Interrogation_Position=267; Antisense; TACGAACTTCTTGGGCAGGGACCGC
>probe:Drosophila_2:1626146_at:722:131; Interrogation_Position=287; Antisense; ACCGCCGTTCACTGAATCTCAATGA
>probe:Drosophila_2:1626146_at:189:421; Interrogation_Position=319; Antisense; GAGCACTTGGAAAGCGACCTGGTCA
>probe:Drosophila_2:1626146_at:554:293; Interrogation_Position=345; Antisense; CGATGCGGACATTAAGCTTCTCTAT
>probe:Drosophila_2:1626146_at:570:659; Interrogation_Position=357; Antisense; TAAGCTTCTCTATGACACCTATGTC
>probe:Drosophila_2:1626146_at:686:219; Interrogation_Position=382; Antisense; AAGTGCGACAAGCATGCGCTCTCAC
>probe:Drosophila_2:1626146_at:78:377; Interrogation_Position=426; Antisense; GAAGCAGCTATCCAAACGTCTTTCG
>probe:Drosophila_2:1626146_at:594:405; Interrogation_Position=476; Antisense; GACTGGTCCTCGAGTGCGTGGCCAA
>probe:Drosophila_2:1626146_at:208:581; Interrogation_Position=494; Antisense; TGGCCAACGAGATGATCCTGCACTG
>probe:Drosophila_2:1626146_at:156:485; Interrogation_Position=68; Antisense; GTAGAAGTACTCCACCGGCGTTGGA

Paste this into a BLAST search page for me
AATGCATGATTTCTGCTGCGACCTGACGAGAGTCCCCAGTTTAGCGACTGAGACGTACATGTTTTGCACCGCAGAACCGCAGAGTGCAGTTTCAACAGTATACGAACTTCTTGGGCAGGGACCGCACCGCCGTTCACTGAATCTCAATGAGAGCACTTGGAAAGCGACCTGGTCACGATGCGGACATTAAGCTTCTCTATTAAGCTTCTCTATGACACCTATGTCAAGTGCGACAAGCATGCGCTCTCACGAAGCAGCTATCCAAACGTCTTTCGGACTGGTCCTCGAGTGCGTGGCCAATGGCCAACGAGATGATCCTGCACTGGTAGAAGTACTCCACCGGCGTTGGA

Full Affymetrix probeset data:

Annotations for 1626146_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime