FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626148_at:

>probe:Drosophila_2:1626148_at:184:331; Interrogation_Position=1025; Antisense; GCGGTGACCCGAATCTGATGCGAGC
>probe:Drosophila_2:1626148_at:516:159; Interrogation_Position=1082; Antisense; ACAAGCTCGGGCTGTGTTTGGACAC
>probe:Drosophila_2:1626148_at:79:587; Interrogation_Position=1100; Antisense; TGGACACCAGTGAATTTCGCATCGA
>probe:Drosophila_2:1626148_at:190:481; Interrogation_Position=1185; Antisense; GTTTGCAGAATACCTAACCCGGGAT
>probe:Drosophila_2:1626148_at:610:445; Interrogation_Position=1207; Antisense; GATGCTCCAATAACGTTTTCCAAGA
>probe:Drosophila_2:1626148_at:171:95; Interrogation_Position=1268; Antisense; AGTTGACCGGCGACCAGCTGTGGAA
>probe:Drosophila_2:1626148_at:411:709; Interrogation_Position=697; Antisense; TTCAATTTGGACATCTGCGGCAGTG
>probe:Drosophila_2:1626148_at:11:35; Interrogation_Position=724; Antisense; ATCAAAATCCTGACCAGTGGCGGCT
>probe:Drosophila_2:1626148_at:49:423; Interrogation_Position=802; Antisense; GAGAAGCGTCCTGGTACAGTGCCCA
>probe:Drosophila_2:1626148_at:181:87; Interrogation_Position=819; Antisense; AGTGCCCAGCGTGTATGCCATGAGC
>probe:Drosophila_2:1626148_at:243:519; Interrogation_Position=907; Antisense; GTGGATCTGTTTAGCATGGACCTCA
>probe:Drosophila_2:1626148_at:53:67; Interrogation_Position=922; Antisense; ATGGACCTCATACTTGTGCCTGTTC
>probe:Drosophila_2:1626148_at:413:167; Interrogation_Position=950; Antisense; AAATGCTCGTTCACTGGTGCCTGGT
>probe:Drosophila_2:1626148_at:299:507; Interrogation_Position=966; Antisense; GTGCCTGGTCATAATCGATTTGCCT

Paste this into a BLAST search page for me
GCGGTGACCCGAATCTGATGCGAGCACAAGCTCGGGCTGTGTTTGGACACTGGACACCAGTGAATTTCGCATCGAGTTTGCAGAATACCTAACCCGGGATGATGCTCCAATAACGTTTTCCAAGAAGTTGACCGGCGACCAGCTGTGGAATTCAATTTGGACATCTGCGGCAGTGATCAAAATCCTGACCAGTGGCGGCTGAGAAGCGTCCTGGTACAGTGCCCAAGTGCCCAGCGTGTATGCCATGAGCGTGGATCTGTTTAGCATGGACCTCAATGGACCTCATACTTGTGCCTGTTCAAATGCTCGTTCACTGGTGCCTGGTGTGCCTGGTCATAATCGATTTGCCT

Full Affymetrix probeset data:

Annotations for 1626148_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720