Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626149_at:

>probe:Drosophila_2:1626149_at:83:1; Interrogation_Position=361; Antisense; ACTCGAACGGAACAGGTAAGACATT
>probe:Drosophila_2:1626149_at:289:381; Interrogation_Position=370; Antisense; GAACAGGTAAGACATTCCGATTTAC
>probe:Drosophila_2:1626149_at:55:213; Interrogation_Position=378; Antisense; AAGACATTCCGATTTACAATTGCGA
>probe:Drosophila_2:1626149_at:79:403; Interrogation_Position=380; Antisense; GACATTCCGATTTACAATTGCGAGA
>probe:Drosophila_2:1626149_at:365:273; Interrogation_Position=382; Antisense; CATTCCGATTTACAATTGCGAGACA
>probe:Drosophila_2:1626149_at:551:631; Interrogation_Position=385; Antisense; TCCGATTTACAATTGCGAGACATGC
>probe:Drosophila_2:1626149_at:19:19; Interrogation_Position=389; Antisense; ATTTACAATTGCGAGACATGCCAGC
>probe:Drosophila_2:1626149_at:615:663; Interrogation_Position=392; Antisense; TACAATTGCGAGACATGCCAGCAAC
>probe:Drosophila_2:1626149_at:213:247; Interrogation_Position=395; Antisense; AATTGCGAGACATGCCAGCAACTTT
>probe:Drosophila_2:1626149_at:358:621; Interrogation_Position=398; Antisense; TGCGAGACATGCCAGCAACTTTCAT
>probe:Drosophila_2:1626149_at:654:325; Interrogation_Position=399; Antisense; GCGAGACATGCCAGCAACTTTCATC
>probe:Drosophila_2:1626149_at:63:423; Interrogation_Position=401; Antisense; GAGACATGCCAGCAACTTTCATCCC
>probe:Drosophila_2:1626149_at:378:401; Interrogation_Position=403; Antisense; GACATGCCAGCAACTTTCATCCCGA
>probe:Drosophila_2:1626149_at:444:45; Interrogation_Position=421; Antisense; ATCCCGACACTCCAGATACTCAAAG

Paste this into a BLAST search page for me
ACTCGAACGGAACAGGTAAGACATTGAACAGGTAAGACATTCCGATTTACAAGACATTCCGATTTACAATTGCGAGACATTCCGATTTACAATTGCGAGACATTCCGATTTACAATTGCGAGACATCCGATTTACAATTGCGAGACATGCATTTACAATTGCGAGACATGCCAGCTACAATTGCGAGACATGCCAGCAACAATTGCGAGACATGCCAGCAACTTTTGCGAGACATGCCAGCAACTTTCATGCGAGACATGCCAGCAACTTTCATCGAGACATGCCAGCAACTTTCATCCCGACATGCCAGCAACTTTCATCCCGAATCCCGACACTCCAGATACTCAAAG

Full Affymetrix probeset data:

Annotations for 1626149_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime