FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626150_at:

>probe:Drosophila_2:1626150_at:170:191; Interrogation_Position=4163; Antisense; AACATTTTTTGGTTTGTCAGCGCCT
>probe:Drosophila_2:1626150_at:94:583; Interrogation_Position=4248; Antisense; TGGCTTTGGCCTGGTGAACCGAGAT
>probe:Drosophila_2:1626150_at:49:429; Interrogation_Position=4268; Antisense; GAGATTCAAGTCAAAGTGCCACGGA
>probe:Drosophila_2:1626150_at:134:507; Interrogation_Position=4283; Antisense; GTGCCACGGATAGAGCCACTGGATG
>probe:Drosophila_2:1626150_at:286:313; Interrogation_Position=4297; Antisense; GCCACTGGATGCATCTGTCTTTAAA
>probe:Drosophila_2:1626150_at:516:67; Interrogation_Position=4325; Antisense; ATGGCGGGCATGATTTGTTTTAACT
>probe:Drosophila_2:1626150_at:666:375; Interrogation_Position=4373; Antisense; GAAGAATCCGCCTTGGAAACTGGGA
>probe:Drosophila_2:1626150_at:493:509; Interrogation_Position=4413; Antisense; GTGACGATTGTGTTAACGACTGTAC
>probe:Drosophila_2:1626150_at:528:29; Interrogation_Position=4456; Antisense; ATACAGTGAGGGTGCTATCTTGGCC
>probe:Drosophila_2:1626150_at:233:115; Interrogation_Position=4482; Antisense; AGCATGATTCCTGCCACGTTCAGTT
>probe:Drosophila_2:1626150_at:709:709; Interrogation_Position=4517; Antisense; TTCAGCAAGCCCTTAGGCCTACTTT
>probe:Drosophila_2:1626150_at:41:393; Interrogation_Position=4559; Antisense; GAAAGCGCCATTTGAATTCCTTGAA
>probe:Drosophila_2:1626150_at:308:105; Interrogation_Position=4584; Antisense; AGACTGGTTCTATCTGCTGATCGGA
>probe:Drosophila_2:1626150_at:89:665; Interrogation_Position=4634; Antisense; TACACCCGAAAACACGAGTCCTTGT

Paste this into a BLAST search page for me
AACATTTTTTGGTTTGTCAGCGCCTTGGCTTTGGCCTGGTGAACCGAGATGAGATTCAAGTCAAAGTGCCACGGAGTGCCACGGATAGAGCCACTGGATGGCCACTGGATGCATCTGTCTTTAAAATGGCGGGCATGATTTGTTTTAACTGAAGAATCCGCCTTGGAAACTGGGAGTGACGATTGTGTTAACGACTGTACATACAGTGAGGGTGCTATCTTGGCCAGCATGATTCCTGCCACGTTCAGTTTTCAGCAAGCCCTTAGGCCTACTTTGAAAGCGCCATTTGAATTCCTTGAAAGACTGGTTCTATCTGCTGATCGGATACACCCGAAAACACGAGTCCTTGT

Full Affymetrix probeset data:

Annotations for 1626150_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720