FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626151_at:

>probe:Drosophila_2:1626151_at:41:235; Interrogation_Position=1024; Antisense; AATGCCACATCCCAAATTCTTGCAA
>probe:Drosophila_2:1626151_at:172:81; Interrogation_Position=1118; Antisense; AGGTGCAATTCACGGCATATGGATT
>probe:Drosophila_2:1626151_at:215:13; Interrogation_Position=1167; Antisense; ATTCAAGATATTTTCGGCCGTCACA
>probe:Drosophila_2:1626151_at:423:121; Interrogation_Position=704; Antisense; AGCGTGGTGACGTCAATCCCAATGT
>probe:Drosophila_2:1626151_at:194:301; Interrogation_Position=721; Antisense; CCCAATGTCAATCCTGCTCTAATGG
>probe:Drosophila_2:1626151_at:577:385; Interrogation_Position=745; Antisense; GAACATTTCCCGGAAGACTCGCTAT
>probe:Drosophila_2:1626151_at:425:405; Interrogation_Position=760; Antisense; GACTCGCTATTCATATACCGCATGC
>probe:Drosophila_2:1626151_at:461:193; Interrogation_Position=791; Antisense; AACTGCTGCGTATCTACAAGGGCAT
>probe:Drosophila_2:1626151_at:537:525; Interrogation_Position=810; Antisense; GGGCATCAACGATTGCTGCAACTTG
>probe:Drosophila_2:1626151_at:585:347; Interrogation_Position=827; Antisense; GCAACTTGATTCTGGTCTCGTTTCT
>probe:Drosophila_2:1626151_at:55:699; Interrogation_Position=848; Antisense; TTCTGGGCTACTCCTTTTACACGGT
>probe:Drosophila_2:1626151_at:656:619; Interrogation_Position=883; Antisense; TGCTACAACCTCTTTGTCCAGATTA
>probe:Drosophila_2:1626151_at:476:131; Interrogation_Position=907; Antisense; ACCGGCAAGGGCATGGTTTCACCAA
>probe:Drosophila_2:1626151_at:282:191; Interrogation_Position=931; Antisense; AACATATTGCAGTGGTGCTTCGCCT

Paste this into a BLAST search page for me
AATGCCACATCCCAAATTCTTGCAAAGGTGCAATTCACGGCATATGGATTATTCAAGATATTTTCGGCCGTCACAAGCGTGGTGACGTCAATCCCAATGTCCCAATGTCAATCCTGCTCTAATGGGAACATTTCCCGGAAGACTCGCTATGACTCGCTATTCATATACCGCATGCAACTGCTGCGTATCTACAAGGGCATGGGCATCAACGATTGCTGCAACTTGGCAACTTGATTCTGGTCTCGTTTCTTTCTGGGCTACTCCTTTTACACGGTTGCTACAACCTCTTTGTCCAGATTAACCGGCAAGGGCATGGTTTCACCAAAACATATTGCAGTGGTGCTTCGCCT

Full Affymetrix probeset data:

Annotations for 1626151_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720