Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626152_at:

>probe:Drosophila_2:1626152_at:270:69; Interrogation_Position=1716; Antisense; AGGAATGCAGTATCTGTCGGCCCAT
>probe:Drosophila_2:1626152_at:226:643; Interrogation_Position=1740; Antisense; TCATTACGTACATCGCGACTTGGCA
>probe:Drosophila_2:1626152_at:342:353; Interrogation_Position=1762; Antisense; GCAGCTCGGAATTGCCTGGTAAACG
>probe:Drosophila_2:1626152_at:626:557; Interrogation_Position=1816; Antisense; GGACTATCCAGAGACATTTACAGCT
>probe:Drosophila_2:1626152_at:495:713; Interrogation_Position=1856; Antisense; TTCAGTCAAAGTCGCTATTGCCTGT
>probe:Drosophila_2:1626152_at:322:691; Interrogation_Position=1871; Antisense; TATTGCCTGTAAGGTGGATGCCCTC
>probe:Drosophila_2:1626152_at:434:547; Interrogation_Position=1886; Antisense; GGATGCCCTCGGAATCGATATTGTA
>probe:Drosophila_2:1626152_at:265:217; Interrogation_Position=1915; Antisense; AAGTTTACGACCGAGAGCGATGTTT
>probe:Drosophila_2:1626152_at:277:561; Interrogation_Position=1978; Antisense; GGAATGCAGCCATACTACGGTTTTA
>probe:Drosophila_2:1626152_at:74:219; Interrogation_Position=2012; Antisense; AAGTAATCAATCTCATCCGTTCACG
>probe:Drosophila_2:1626152_at:196:145; Interrogation_Position=2068; Antisense; ACTGCTGTCTACTCGCTAATGATCG
>probe:Drosophila_2:1626152_at:369:409; Interrogation_Position=2104; Antisense; GAGCAGTCAGTAAAACGTCCAACAT
>probe:Drosophila_2:1626152_at:369:427; Interrogation_Position=2138; Antisense; TTTCGAACCGTCTCAAAACTTGGCA
>probe:Drosophila_2:1626152_at:301:191; Interrogation_Position=2154; Antisense; AACTTGGCACGAGGGCCACTTTAAG

Paste this into a BLAST search page for me
AGGAATGCAGTATCTGTCGGCCCATTCATTACGTACATCGCGACTTGGCAGCAGCTCGGAATTGCCTGGTAAACGGGACTATCCAGAGACATTTACAGCTTTCAGTCAAAGTCGCTATTGCCTGTTATTGCCTGTAAGGTGGATGCCCTCGGATGCCCTCGGAATCGATATTGTAAAGTTTACGACCGAGAGCGATGTTTGGAATGCAGCCATACTACGGTTTTAAAGTAATCAATCTCATCCGTTCACGACTGCTGTCTACTCGCTAATGATCGGAGCAGTCAGTAAAACGTCCAACATTTTCGAACCGTCTCAAAACTTGGCAAACTTGGCACGAGGGCCACTTTAAG

Full Affymetrix probeset data:

Annotations for 1626152_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime