Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626154_at:

>probe:Drosophila_2:1626154_at:156:121; Interrogation_Position=1302; Antisense; AGCTGTTTCACCCACTCAAGAGACG
>probe:Drosophila_2:1626154_at:160:291; Interrogation_Position=1362; Antisense; CGGTGTGGCGCTTATCGACTACAGC
>probe:Drosophila_2:1626154_at:618:327; Interrogation_Position=1385; Antisense; GCGATCTGCATGTGCTCGACTTTGA
>probe:Drosophila_2:1626154_at:156:693; Interrogation_Position=1405; Antisense; TTTGAGCCCACTCTAAAAACCCTGG
>probe:Drosophila_2:1626154_at:427:653; Interrogation_Position=1445; Antisense; TCAAGCACCAGCTGGACATCTCGGG
>probe:Drosophila_2:1626154_at:662:719; Interrogation_Position=1483; Antisense; TTCCGCTCGGACCTGCAGATGCTGA
>probe:Drosophila_2:1626154_at:640:293; Interrogation_Position=1514; Antisense; CGAACAGTATTAGCCGGCCCATCAA
>probe:Drosophila_2:1626154_at:674:31; Interrogation_Position=1534; Antisense; ATCAACCAAGCTGGCTAGCGTCCAA
>probe:Drosophila_2:1626154_at:439:339; Interrogation_Position=1547; Antisense; GCTAGCGTCCAAAGCCGTAAGGAAT
>probe:Drosophila_2:1626154_at:485:563; Interrogation_Position=1567; Antisense; GGAATAAGCCGGAGTCGACTGCCAC
>probe:Drosophila_2:1626154_at:377:533; Interrogation_Position=1615; Antisense; GGTGTTGAATCACGGAGCCACTAGT
>probe:Drosophila_2:1626154_at:341:313; Interrogation_Position=1631; Antisense; GCCACTAGTCCGGTTCTTTGTATTG
>probe:Drosophila_2:1626154_at:711:479; Interrogation_Position=1650; Antisense; GTATTGGAGCTCGAATAACACTTTC
>probe:Drosophila_2:1626154_at:223:179; Interrogation_Position=1742; Antisense; AAACTTGCTTTTGGTACTTCTGATA

Paste this into a BLAST search page for me
AGCTGTTTCACCCACTCAAGAGACGCGGTGTGGCGCTTATCGACTACAGCGCGATCTGCATGTGCTCGACTTTGATTTGAGCCCACTCTAAAAACCCTGGTCAAGCACCAGCTGGACATCTCGGGTTCCGCTCGGACCTGCAGATGCTGACGAACAGTATTAGCCGGCCCATCAAATCAACCAAGCTGGCTAGCGTCCAAGCTAGCGTCCAAAGCCGTAAGGAATGGAATAAGCCGGAGTCGACTGCCACGGTGTTGAATCACGGAGCCACTAGTGCCACTAGTCCGGTTCTTTGTATTGGTATTGGAGCTCGAATAACACTTTCAAACTTGCTTTTGGTACTTCTGATA

Full Affymetrix probeset data:

Annotations for 1626154_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime