FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626155_at:

>probe:Drosophila_2:1626155_at:4:563; Interrogation_Position=306; Antisense; GGAACTCCATCTTTTTGAGCCTAGG
>probe:Drosophila_2:1626155_at:720:415; Interrogation_Position=322; Antisense; GAGCCTAGGCTTTCTTATCCTCAAT
>probe:Drosophila_2:1626155_at:259:435; Interrogation_Position=353; Antisense; GAGGTCCTTCAAAGCTTCAATCTGT
>probe:Drosophila_2:1626155_at:307:189; Interrogation_Position=381; Antisense; AACAGCTGGCTGTAGTCGGCATGAT
>probe:Drosophila_2:1626155_at:255:61; Interrogation_Position=447; Antisense; ATGTGCGATTCCATCTTTACGAGCG
>probe:Drosophila_2:1626155_at:456:605; Interrogation_Position=474; Antisense; TGATCCGCGCCGATTTCAATGTGCA
>probe:Drosophila_2:1626155_at:262:507; Interrogation_Position=518; Antisense; GTGCGCGTGGTCAACTGTGTAAATC
>probe:Drosophila_2:1626155_at:224:599; Interrogation_Position=535; Antisense; TGTAAATCGCTGCTTGGTCACGCTG
>probe:Drosophila_2:1626155_at:623:343; Interrogation_Position=559; Antisense; GCATTGCATCCTCTTTCAAACTGAA
>probe:Drosophila_2:1626155_at:367:143; Interrogation_Position=578; Antisense; ACTGAAATCTTCGAGCTCTTTTTGA
>probe:Drosophila_2:1626155_at:484:645; Interrogation_Position=594; Antisense; TCTTTTTGATGATGCTTGCCCTGGA
>probe:Drosophila_2:1626155_at:148:509; Interrogation_Position=678; Antisense; GTGTGACGTTGTTTTTTCCAAGGCT
>probe:Drosophila_2:1626155_at:526:51; Interrogation_Position=723; Antisense; ATGCGTCGAGCAGAGCCTATTATCA
>probe:Drosophila_2:1626155_at:168:619; Interrogation_Position=798; Antisense; TGCATCTAGGCATCATTGAGCGCTG

Paste this into a BLAST search page for me
GGAACTCCATCTTTTTGAGCCTAGGGAGCCTAGGCTTTCTTATCCTCAATGAGGTCCTTCAAAGCTTCAATCTGTAACAGCTGGCTGTAGTCGGCATGATATGTGCGATTCCATCTTTACGAGCGTGATCCGCGCCGATTTCAATGTGCAGTGCGCGTGGTCAACTGTGTAAATCTGTAAATCGCTGCTTGGTCACGCTGGCATTGCATCCTCTTTCAAACTGAAACTGAAATCTTCGAGCTCTTTTTGATCTTTTTGATGATGCTTGCCCTGGAGTGTGACGTTGTTTTTTCCAAGGCTATGCGTCGAGCAGAGCCTATTATCATGCATCTAGGCATCATTGAGCGCTG

Full Affymetrix probeset data:

Annotations for 1626155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720