FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626156_at:

>probe:Drosophila_2:1626156_at:268:107; Interrogation_Position=106; Antisense; AAATCCTACCCAAGGCGGTGGTCTG
>probe:Drosophila_2:1626156_at:240:715; Interrogation_Position=162; Antisense; TTCTCGTCGGGCTGTGTGGTTCATC
>probe:Drosophila_2:1626156_at:470:589; Interrogation_Position=178; Antisense; TGGTTCATCCGAGTGCCACCGTTAT
>probe:Drosophila_2:1626156_at:429:319; Interrogation_Position=204; Antisense; GCCGACGCAGGTCCCATAATAATTG
>probe:Drosophila_2:1626156_at:729:81; Interrogation_Position=245; Antisense; AGAGGAATATGCCACCGTAGCTCAC
>probe:Drosophila_2:1626156_at:565:289; Interrogation_Position=280; Antisense; CGGGCGCCGTTTGGGATGTCAACAA
>probe:Drosophila_2:1626156_at:453:419; Interrogation_Position=311; Antisense; GAGCATTGGCACTCACAATGTCTTT
>probe:Drosophila_2:1626156_at:51:251; Interrogation_Position=326; Antisense; CAATGTCTTTGAAGTCGGCTGCCAA
>probe:Drosophila_2:1626156_at:300:381; Interrogation_Position=377; Antisense; GAACGTCTTCGAGAGCAAGTGCTAT
>probe:Drosophila_2:1626156_at:571:513; Interrogation_Position=412; Antisense; GTGTCACTGTTTCCAGCGGTTGTGT
>probe:Drosophila_2:1626156_at:562:213; Interrogation_Position=453; Antisense; AAGATCCATGGTAGTCAACGCCTGC
>probe:Drosophila_2:1626156_at:450:199; Interrogation_Position=469; Antisense; AACGCCTGCCCGAAAACACGATTGT
>probe:Drosophila_2:1626156_at:44:83; Interrogation_Position=535; Antisense; AGGGATCGCAGACCCTGCAGATCGA
>probe:Drosophila_2:1626156_at:602:223; Interrogation_Position=570; Antisense; AAGGTCCTGCCAAACTATCATCATC

Paste this into a BLAST search page for me
AAATCCTACCCAAGGCGGTGGTCTGTTCTCGTCGGGCTGTGTGGTTCATCTGGTTCATCCGAGTGCCACCGTTATGCCGACGCAGGTCCCATAATAATTGAGAGGAATATGCCACCGTAGCTCACCGGGCGCCGTTTGGGATGTCAACAAGAGCATTGGCACTCACAATGTCTTTCAATGTCTTTGAAGTCGGCTGCCAAGAACGTCTTCGAGAGCAAGTGCTATGTGTCACTGTTTCCAGCGGTTGTGTAAGATCCATGGTAGTCAACGCCTGCAACGCCTGCCCGAAAACACGATTGTAGGGATCGCAGACCCTGCAGATCGAAAGGTCCTGCCAAACTATCATCATC

Full Affymetrix probeset data:

Annotations for 1626156_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720