FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626159_at:

>probe:Drosophila_2:1626159_at:449:283; Interrogation_Position=155; Antisense; CTGCCCATGTCTTTTGTTTTCGTTT
>probe:Drosophila_2:1626159_at:59:299; Interrogation_Position=184; Antisense; CGCTTCTTCGGTGAGTCAAACGCAT
>probe:Drosophila_2:1626159_at:364:31; Interrogation_Position=239; Antisense; ATAACGAGCCGTTGAATGCTGTACC
>probe:Drosophila_2:1626159_at:217:717; Interrogation_Position=250; Antisense; TTGAATGCTGTACCGGCGCGTAAAC
>probe:Drosophila_2:1626159_at:130:323; Interrogation_Position=265; Antisense; GCGCGTAAACACTTGGTCTGCTCAA
>probe:Drosophila_2:1626159_at:640:641; Interrogation_Position=281; Antisense; TCTGCTCAAACTTCGACCTTCTAGG
>probe:Drosophila_2:1626159_at:729:503; Interrogation_Position=317; Antisense; GTGAGTTCAAAACCTTTTCGAAGCG
>probe:Drosophila_2:1626159_at:216:709; Interrogation_Position=365; Antisense; TTCGCAAAGCTCCAAATTGTCAATG
>probe:Drosophila_2:1626159_at:672:347; Interrogation_Position=399; Antisense; GCAGGCTTTTAATGCTCGATTCCTA
>probe:Drosophila_2:1626159_at:664:113; Interrogation_Position=463; Antisense; AGCAGCCCAGCTAAAATGACCAAGG
>probe:Drosophila_2:1626159_at:282:561; Interrogation_Position=516; Antisense; GGAAAACTCTGACAGGACCCAGCTA
>probe:Drosophila_2:1626159_at:30:155; Interrogation_Position=527; Antisense; ACAGGACCCAGCTACGCGGAAGGAG
>probe:Drosophila_2:1626159_at:546:289; Interrogation_Position=56; Antisense; CGTCGTCGTCCTCGGCAATGGTTGT
>probe:Drosophila_2:1626159_at:398:227; Interrogation_Position=71; Antisense; CAATGGTTGTCCTCGTCGTCGGGCC

Paste this into a BLAST search page for me
CTGCCCATGTCTTTTGTTTTCGTTTCGCTTCTTCGGTGAGTCAAACGCATATAACGAGCCGTTGAATGCTGTACCTTGAATGCTGTACCGGCGCGTAAACGCGCGTAAACACTTGGTCTGCTCAATCTGCTCAAACTTCGACCTTCTAGGGTGAGTTCAAAACCTTTTCGAAGCGTTCGCAAAGCTCCAAATTGTCAATGGCAGGCTTTTAATGCTCGATTCCTAAGCAGCCCAGCTAAAATGACCAAGGGGAAAACTCTGACAGGACCCAGCTAACAGGACCCAGCTACGCGGAAGGAGCGTCGTCGTCCTCGGCAATGGTTGTCAATGGTTGTCCTCGTCGTCGGGCC

Full Affymetrix probeset data:

Annotations for 1626159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720