Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626165_at:

>probe:Drosophila_2:1626165_at:646:161; Interrogation_Position=1496; Antisense; ACAATTGCGGCAAGGCGATGCCCTT
>probe:Drosophila_2:1626165_at:680:533; Interrogation_Position=1546; Antisense; GGTGAGCATCTGTTGGCCGCCAATT
>probe:Drosophila_2:1626165_at:311:727; Interrogation_Position=1558; Antisense; TTGGCCGCCAATTCGATAGCTAATC
>probe:Drosophila_2:1626165_at:429:237; Interrogation_Position=1579; Antisense; AATCGTGCCACCATTATTTTGAGTA
>probe:Drosophila_2:1626165_at:455:519; Interrogation_Position=1618; Antisense; GTGGATGGTGATGCCACTGCCACAG
>probe:Drosophila_2:1626165_at:556:261; Interrogation_Position=1640; Antisense; CAGCGGCAACGGCACTAAGTTCAAC
>probe:Drosophila_2:1626165_at:609:657; Interrogation_Position=1655; Antisense; TAAGTTCAACGGTTGGCGGCGGCAT
>probe:Drosophila_2:1626165_at:478:271; Interrogation_Position=1677; Antisense; CATCGGTGGCATTGGTGGCAGTATA
>probe:Drosophila_2:1626165_at:669:627; Interrogation_Position=1710; Antisense; TGCCAGTGCCACAGATATCGAGACG
>probe:Drosophila_2:1626165_at:627:197; Interrogation_Position=1744; Antisense; AACGGTGCCCGGGATGCCATTGTTG
>probe:Drosophila_2:1626165_at:136:161; Interrogation_Position=1811; Antisense; ACAACGAGTACAGCATCCTGCAGCT
>probe:Drosophila_2:1626165_at:482:353; Interrogation_Position=1830; Antisense; GCAGCTGAACAACACGATCATCCAG
>probe:Drosophila_2:1626165_at:335:199; Interrogation_Position=1864; Antisense; AACGACGATGACTTTCGCGCCCTGG
>probe:Drosophila_2:1626165_at:548:651; Interrogation_Position=1898; Antisense; TCAAGCGCAAGGTCGAGTACACGGA

Paste this into a BLAST search page for me
ACAATTGCGGCAAGGCGATGCCCTTGGTGAGCATCTGTTGGCCGCCAATTTTGGCCGCCAATTCGATAGCTAATCAATCGTGCCACCATTATTTTGAGTAGTGGATGGTGATGCCACTGCCACAGCAGCGGCAACGGCACTAAGTTCAACTAAGTTCAACGGTTGGCGGCGGCATCATCGGTGGCATTGGTGGCAGTATATGCCAGTGCCACAGATATCGAGACGAACGGTGCCCGGGATGCCATTGTTGACAACGAGTACAGCATCCTGCAGCTGCAGCTGAACAACACGATCATCCAGAACGACGATGACTTTCGCGCCCTGGTCAAGCGCAAGGTCGAGTACACGGA

Full Affymetrix probeset data:

Annotations for 1626165_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime