Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626166_at:

>probe:Drosophila_2:1626166_at:388:323; Interrogation_Position=1024; Antisense; GCGCTCCTGGCAACTGGACGAGGAA
>probe:Drosophila_2:1626166_at:615:549; Interrogation_Position=1039; Antisense; GGACGAGGAACCCACTCGGGCACAA
>probe:Drosophila_2:1626166_at:223:413; Interrogation_Position=1067; Antisense; GTGGAACCGGAGATCGTTAGCTTCG
>probe:Drosophila_2:1626166_at:250:625; Interrogation_Position=1154; Antisense; TGCGCTCGCGGAGAACGTCGTGATA
>probe:Drosophila_2:1626166_at:172:383; Interrogation_Position=1166; Antisense; GAACGTCGTGATAGCTACGGCGAAT
>probe:Drosophila_2:1626166_at:722:369; Interrogation_Position=1187; Antisense; GAATGTCGCCAGATCGAGGGCTATT
>probe:Drosophila_2:1626166_at:326:609; Interrogation_Position=1223; Antisense; TGAGAACGCCAGACTGCCAGCTTAA
>probe:Drosophila_2:1626166_at:685:475; Interrogation_Position=1250; Antisense; GTTAGTTTCATACATTGCACACTCT
>probe:Drosophila_2:1626166_at:432:615; Interrogation_Position=1265; Antisense; TGCACACTCTAGAATTAAGCCGACG
>probe:Drosophila_2:1626166_at:450:325; Interrogation_Position=1379; Antisense; GCGACTAACATTAAGCACCATTACA
>probe:Drosophila_2:1626166_at:117:465; Interrogation_Position=1437; Antisense; GATTGCAAATCACCTTCTATGTAGA
>probe:Drosophila_2:1626166_at:194:645; Interrogation_Position=1452; Antisense; TCTATGTAGATGCTCCAACGGCGGA
>probe:Drosophila_2:1626166_at:201:611; Interrogation_Position=900; Antisense; TGACCGGCGGCGATTATGCCAGTCC
>probe:Drosophila_2:1626166_at:480:699; Interrogation_Position=945; Antisense; TTTACCGCAGCGATCTTGGCAGAGG

Paste this into a BLAST search page for me
GCGCTCCTGGCAACTGGACGAGGAAGGACGAGGAACCCACTCGGGCACAAGTGGAACCGGAGATCGTTAGCTTCGTGCGCTCGCGGAGAACGTCGTGATAGAACGTCGTGATAGCTACGGCGAATGAATGTCGCCAGATCGAGGGCTATTTGAGAACGCCAGACTGCCAGCTTAAGTTAGTTTCATACATTGCACACTCTTGCACACTCTAGAATTAAGCCGACGGCGACTAACATTAAGCACCATTACAGATTGCAAATCACCTTCTATGTAGATCTATGTAGATGCTCCAACGGCGGATGACCGGCGGCGATTATGCCAGTCCTTTACCGCAGCGATCTTGGCAGAGG

Full Affymetrix probeset data:

Annotations for 1626166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime