Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626167_at:

>probe:Drosophila_2:1626167_at:594:449; Interrogation_Position=1020; Antisense; GATCCCGAGATGAGGTGCGCTTGCC
>probe:Drosophila_2:1626167_at:662:323; Interrogation_Position=1036; Antisense; GCGCTTGCCGCGTTACCTGGAAAAG
>probe:Drosophila_2:1626167_at:459:521; Interrogation_Position=1122; Antisense; GTGGCCATGTGTTGCTCAGCGATCA
>probe:Drosophila_2:1626167_at:680:231; Interrogation_Position=1199; Antisense; AATGAACTGAACCACATGCCCATGA
>probe:Drosophila_2:1626167_at:83:51; Interrogation_Position=1214; Antisense; ATGCCCATGACTGCACAGACGTTGA
>probe:Drosophila_2:1626167_at:156:449; Interrogation_Position=1261; Antisense; GATCGACAAGGAGCTGACCACCGTG
>probe:Drosophila_2:1626167_at:718:437; Interrogation_Position=1289; Antisense; GAGGACATCCGCATATACTCCAAGG
>probe:Drosophila_2:1626167_at:202:227; Interrogation_Position=1310; Antisense; AAGGCAAAGGTCTTCGTGCTGGCCA
>probe:Drosophila_2:1626167_at:195:509; Interrogation_Position=1325; Antisense; GTGCTGGCCAGCAAGTCGCGACAGT
>probe:Drosophila_2:1626167_at:404:107; Interrogation_Position=1354; Antisense; AGAACTCATGCTACATAGCTCCCAA
>probe:Drosophila_2:1626167_at:370:663; Interrogation_Position=1385; Antisense; TAAAGCATTCCATCGACTGACTGAC
>probe:Drosophila_2:1626167_at:464:417; Interrogation_Position=1411; Antisense; GAGCGAGCTACTGGAATCTTGGATT
>probe:Drosophila_2:1626167_at:255:607; Interrogation_Position=1493; Antisense; TGAGATTTGGATCGCAGACCTACCC
>probe:Drosophila_2:1626167_at:658:595; Interrogation_Position=1532; Antisense; TGTGACCAACTTAACGTGCGATCCA

Paste this into a BLAST search page for me
GATCCCGAGATGAGGTGCGCTTGCCGCGCTTGCCGCGTTACCTGGAAAAGGTGGCCATGTGTTGCTCAGCGATCAAATGAACTGAACCACATGCCCATGAATGCCCATGACTGCACAGACGTTGAGATCGACAAGGAGCTGACCACCGTGGAGGACATCCGCATATACTCCAAGGAAGGCAAAGGTCTTCGTGCTGGCCAGTGCTGGCCAGCAAGTCGCGACAGTAGAACTCATGCTACATAGCTCCCAATAAAGCATTCCATCGACTGACTGACGAGCGAGCTACTGGAATCTTGGATTTGAGATTTGGATCGCAGACCTACCCTGTGACCAACTTAACGTGCGATCCA

Full Affymetrix probeset data:

Annotations for 1626167_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime