Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626168_at:

>probe:Drosophila_2:1626168_at:703:139; Interrogation_Position=107; Antisense; ACGTCCGCAGCTCGATGAATTCTGG
>probe:Drosophila_2:1626168_at:401:283; Interrogation_Position=162; Antisense; CTGCCCGCTGATTTCCAAAAGCTGA
>probe:Drosophila_2:1626168_at:654:217; Interrogation_Position=246; Antisense; AAGTCCGGACTTTCCCAAGTGACAG
>probe:Drosophila_2:1626168_at:707:611; Interrogation_Position=265; Antisense; TGACAGTCGCTGAGGCCTGGCTAAA
>probe:Drosophila_2:1626168_at:385:287; Interrogation_Position=281; Antisense; CTGGCTAAATGTTCTGGTCACCGTG
>probe:Drosophila_2:1626168_at:63:403; Interrogation_Position=311; Antisense; GATTACCTGGTTCTACATGGGCGAG
>probe:Drosophila_2:1626168_at:517:77; Interrogation_Position=334; Antisense; AGGTTATCGGTCGTCGTCACCTGGT
>probe:Drosophila_2:1626168_at:160:299; Interrogation_Position=350; Antisense; TCACCTGGTCGGCTACAAGGTTTAG
>probe:Drosophila_2:1626168_at:495:11; Interrogation_Position=391; Antisense; ATTCTCCTTATGTTTTTGTGTTGTA
>probe:Drosophila_2:1626168_at:630:725; Interrogation_Position=406; Antisense; TTGTGTTGTATGCAAATGGCCCAGT
>probe:Drosophila_2:1626168_at:109:229; Interrogation_Position=420; Antisense; AATGGCCCAGTGCATTTAAGCCCTT
>probe:Drosophila_2:1626168_at:686:15; Interrogation_Position=433; Antisense; ATTTAAGCCCTTTTTCTGTGGCCAG
>probe:Drosophila_2:1626168_at:670:715; Interrogation_Position=446; Antisense; TTCTGTGGCCAGGTGCACTGAATAA
>probe:Drosophila_2:1626168_at:326:167; Interrogation_Position=91; Antisense; AAATGATTGTGGCAGCACGTCCGCA

Paste this into a BLAST search page for me
ACGTCCGCAGCTCGATGAATTCTGGCTGCCCGCTGATTTCCAAAAGCTGAAAGTCCGGACTTTCCCAAGTGACAGTGACAGTCGCTGAGGCCTGGCTAAACTGGCTAAATGTTCTGGTCACCGTGGATTACCTGGTTCTACATGGGCGAGAGGTTATCGGTCGTCGTCACCTGGTTCACCTGGTCGGCTACAAGGTTTAGATTCTCCTTATGTTTTTGTGTTGTATTGTGTTGTATGCAAATGGCCCAGTAATGGCCCAGTGCATTTAAGCCCTTATTTAAGCCCTTTTTCTGTGGCCAGTTCTGTGGCCAGGTGCACTGAATAAAAATGATTGTGGCAGCACGTCCGCA

Full Affymetrix probeset data:

Annotations for 1626168_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime