Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626169_at:

>probe:Drosophila_2:1626169_at:175:233; Interrogation_Position=1834; Antisense; AATGCGGAACAGTTGCTGGACGACA
>probe:Drosophila_2:1626169_at:279:397; Interrogation_Position=1855; Antisense; GACAAGCGCGACCTGAAGCAGCTAA
>probe:Drosophila_2:1626169_at:455:75; Interrogation_Position=1880; Antisense; AGGAGCGCTACCAGAAGTACGCCAT
>probe:Drosophila_2:1626169_at:56:671; Interrogation_Position=1948; Antisense; TACGACGACAGCTACGAGGCTCAAA
>probe:Drosophila_2:1626169_at:506:181; Interrogation_Position=1970; Antisense; AAAACGAGGGTCAAGCGCCGCCTGT
>probe:Drosophila_2:1626169_at:301:641; Interrogation_Position=1998; Antisense; TCTGCTGCGCGGAAGGCTCCAGGAA
>probe:Drosophila_2:1626169_at:375:637; Interrogation_Position=2110; Antisense; TCGATGCGCACCAACAGAGACTTTT
>probe:Drosophila_2:1626169_at:109:109; Interrogation_Position=2138; Antisense; AGAATCCAGAGGTGATACGCGCCCG
>probe:Drosophila_2:1626169_at:318:113; Interrogation_Position=2168; Antisense; AGCAGCGCCAGTTATCCAAATACGG
>probe:Drosophila_2:1626169_at:726:117; Interrogation_Position=2214; Antisense; AGCGAGTCCCTCTGTGGTCGGAGCA
>probe:Drosophila_2:1626169_at:711:295; Interrogation_Position=2267; Antisense; CGCAGCGCAGTCGTGGCCAAAAGGA
>probe:Drosophila_2:1626169_at:614:181; Interrogation_Position=2285; Antisense; AAAAGGAGGCCCACAAGTCCACTCG
>probe:Drosophila_2:1626169_at:312:219; Interrogation_Position=2299; Antisense; AAGTCCACTCGTGCCAATCATAATC
>probe:Drosophila_2:1626169_at:617:75; Interrogation_Position=2331; Antisense; AGGAGCAGCCTTCAAGCGCAGCAAG

Paste this into a BLAST search page for me
AATGCGGAACAGTTGCTGGACGACAGACAAGCGCGACCTGAAGCAGCTAAAGGAGCGCTACCAGAAGTACGCCATTACGACGACAGCTACGAGGCTCAAAAAAACGAGGGTCAAGCGCCGCCTGTTCTGCTGCGCGGAAGGCTCCAGGAATCGATGCGCACCAACAGAGACTTTTAGAATCCAGAGGTGATACGCGCCCGAGCAGCGCCAGTTATCCAAATACGGAGCGAGTCCCTCTGTGGTCGGAGCACGCAGCGCAGTCGTGGCCAAAAGGAAAAAGGAGGCCCACAAGTCCACTCGAAGTCCACTCGTGCCAATCATAATCAGGAGCAGCCTTCAAGCGCAGCAAG

Full Affymetrix probeset data:

Annotations for 1626169_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime