Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626175_at:

>probe:Drosophila_2:1626175_at:283:165; Interrogation_Position=1071; Antisense; AAATCTGGTGCATATGCGCCACTAT
>probe:Drosophila_2:1626175_at:174:685; Interrogation_Position=1093; Antisense; TATCTGGCTGCCTGCAAGATTGCCA
>probe:Drosophila_2:1626175_at:357:35; Interrogation_Position=1136; Antisense; ATCAGCAACTGGGTGTCCGGCGACA
>probe:Drosophila_2:1626175_at:541:39; Interrogation_Position=1160; Antisense; ATCTGGCCCAGTCAAATGAGTTCTA
>probe:Drosophila_2:1626175_at:212:713; Interrogation_Position=1180; Antisense; TTCTATTCCCTAAGTGATCTCAGCC
>probe:Drosophila_2:1626175_at:345:417; Interrogation_Position=1217; Antisense; GAGCGCTGAGCGAATTTCTGCAAGG
>probe:Drosophila_2:1626175_at:491:275; Interrogation_Position=1288; Antisense; CTTGCCCAAGCGTACATTTGCGAGA
>probe:Drosophila_2:1626175_at:472:183; Interrogation_Position=1321; Antisense; AACAACGAGGTGATCTTTCCCTTCG
>probe:Drosophila_2:1626175_at:368:719; Interrogation_Position=1337; Antisense; TTCCCTTCGACGATGGCTGCATCAA
>probe:Drosophila_2:1626175_at:628:513; Interrogation_Position=1364; Antisense; GTGATCAGTGCAATTCCATCTTCCA
>probe:Drosophila_2:1626175_at:211:605; Interrogation_Position=1415; Antisense; TGATTTGCCCCAAATGCATTCGCAT
>probe:Drosophila_2:1626175_at:521:53; Interrogation_Position=1428; Antisense; ATGCATTCGCATCCAAGAGCGGCGT
>probe:Drosophila_2:1626175_at:658:417; Interrogation_Position=1444; Antisense; GAGCGGCGTCTTCAATTGGATCGCA
>probe:Drosophila_2:1626175_at:159:445; Interrogation_Position=1516; Antisense; GATGATGACGTGACTGCCGCAGAAT

Paste this into a BLAST search page for me
AAATCTGGTGCATATGCGCCACTATTATCTGGCTGCCTGCAAGATTGCCAATCAGCAACTGGGTGTCCGGCGACAATCTGGCCCAGTCAAATGAGTTCTATTCTATTCCCTAAGTGATCTCAGCCGAGCGCTGAGCGAATTTCTGCAAGGCTTGCCCAAGCGTACATTTGCGAGAAACAACGAGGTGATCTTTCCCTTCGTTCCCTTCGACGATGGCTGCATCAAGTGATCAGTGCAATTCCATCTTCCATGATTTGCCCCAAATGCATTCGCATATGCATTCGCATCCAAGAGCGGCGTGAGCGGCGTCTTCAATTGGATCGCAGATGATGACGTGACTGCCGCAGAAT

Full Affymetrix probeset data:

Annotations for 1626175_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime