FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626180_at:

>probe:Drosophila_2:1626180_at:230:359; Interrogation_Position=1014; Antisense; GCAATCAACGCCTCGGTTAAGTGGT
>probe:Drosophila_2:1626180_at:75:381; Interrogation_Position=542; Antisense; GAACCACGCCTACCACGATAAATAT
>probe:Drosophila_2:1626180_at:649:163; Interrogation_Position=561; Antisense; AAATATGGCCGGGTGTACACCTCGG
>probe:Drosophila_2:1626180_at:516:639; Interrogation_Position=582; Antisense; TCGGTCATTCCGTGCAACATATTCG
>probe:Drosophila_2:1626180_at:688:653; Interrogation_Position=623; Antisense; TAATCCAGAGGTCAGCCACGTTATT
>probe:Drosophila_2:1626180_at:189:453; Interrogation_Position=656; Antisense; GATCTATAGGATGCACCAGCTGGTT
>probe:Drosophila_2:1626180_at:57:423; Interrogation_Position=684; Antisense; GAGAAGACTGACGTCCCCGAAAACG
>probe:Drosophila_2:1626180_at:474:601; Interrogation_Position=715; Antisense; TGTTCACCGTTTTCGGAAGCGGCAT
>probe:Drosophila_2:1626180_at:384:1; Interrogation_Position=740; Antisense; GCCACTACGGCAGTTTGTATACTCC
>probe:Drosophila_2:1626180_at:380:221; Interrogation_Position=809; Antisense; AAGTGTGGAGCCCATCATCCTAAGC
>probe:Drosophila_2:1626180_at:718:521; Interrogation_Position=867; Antisense; GTGGCCCAAGCCGTTGCAAAAGCAT
>probe:Drosophila_2:1626180_at:588:375; Interrogation_Position=904; Antisense; GAAGACTGGTCTGTGATACGAGCAA
>probe:Drosophila_2:1626180_at:343:103; Interrogation_Position=949; Antisense; AGACTGCGTCTAATGCCAAGCTTCG
>probe:Drosophila_2:1626180_at:183:405; Interrogation_Position=987; Antisense; GACTACGCATTTACGGACTTGGAAA

Paste this into a BLAST search page for me
GCAATCAACGCCTCGGTTAAGTGGTGAACCACGCCTACCACGATAAATATAAATATGGCCGGGTGTACACCTCGGTCGGTCATTCCGTGCAACATATTCGTAATCCAGAGGTCAGCCACGTTATTGATCTATAGGATGCACCAGCTGGTTGAGAAGACTGACGTCCCCGAAAACGTGTTCACCGTTTTCGGAAGCGGCATGCCACTACGGCAGTTTGTATACTCCAAGTGTGGAGCCCATCATCCTAAGCGTGGCCCAAGCCGTTGCAAAAGCATGAAGACTGGTCTGTGATACGAGCAAAGACTGCGTCTAATGCCAAGCTTCGGACTACGCATTTACGGACTTGGAAA

Full Affymetrix probeset data:

Annotations for 1626180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720