FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626181_at:

>probe:Drosophila_2:1626181_at:655:489; Interrogation_Position=100; Antisense; GTACTATGTAATTTATGCGCCAAAA
>probe:Drosophila_2:1626181_at:156:231; Interrogation_Position=153; Antisense; AATGAGGCAAAACCAGTTGGCCACC
>probe:Drosophila_2:1626181_at:622:463; Interrogation_Position=168; Antisense; GTTGGCCACCAACGAATCGAAAGTG
>probe:Drosophila_2:1626181_at:508:389; Interrogation_Position=203; Antisense; GAAACCAGTTCTTGATACCATTCCT
>probe:Drosophila_2:1626181_at:176:605; Interrogation_Position=215; Antisense; TGATACCATTCCTGTTATCGCGGCT
>probe:Drosophila_2:1626181_at:210:261; Interrogation_Position=241; Antisense; CACCTTCTTACCTGTTGACTGAGTT
>probe:Drosophila_2:1626181_at:387:477; Interrogation_Position=263; Antisense; GTTTTACCTTCAGTTTTGCCTCCAT
>probe:Drosophila_2:1626181_at:411:357; Interrogation_Position=330; Antisense; GCAACTTACGGTAGTCGCAATCACT
>probe:Drosophila_2:1626181_at:240:193; Interrogation_Position=357; Antisense; AACTCAGTCCATAGAAAGCATCCCT
>probe:Drosophila_2:1626181_at:383:347; Interrogation_Position=374; Antisense; GCATCCCTAATCAGCAAATCACTCA
>probe:Drosophila_2:1626181_at:575:59; Interrogation_Position=413; Antisense; ATGTACAATTATCTCCCATCTTGAT
>probe:Drosophila_2:1626181_at:69:193; Interrogation_Position=464; Antisense; AACTCTATACTTTGAATTCTACAGG
>probe:Drosophila_2:1626181_at:278:587; Interrogation_Position=72; Antisense; TGGATCTACGCACTTTACCGGTTTG
>probe:Drosophila_2:1626181_at:157:131; Interrogation_Position=88; Antisense; ACCGGTTTGCTCGTACTATGTAATT

Paste this into a BLAST search page for me
GTACTATGTAATTTATGCGCCAAAAAATGAGGCAAAACCAGTTGGCCACCGTTGGCCACCAACGAATCGAAAGTGGAAACCAGTTCTTGATACCATTCCTTGATACCATTCCTGTTATCGCGGCTCACCTTCTTACCTGTTGACTGAGTTGTTTTACCTTCAGTTTTGCCTCCATGCAACTTACGGTAGTCGCAATCACTAACTCAGTCCATAGAAAGCATCCCTGCATCCCTAATCAGCAAATCACTCAATGTACAATTATCTCCCATCTTGATAACTCTATACTTTGAATTCTACAGGTGGATCTACGCACTTTACCGGTTTGACCGGTTTGCTCGTACTATGTAATT

Full Affymetrix probeset data:

Annotations for 1626181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720