Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626184_at:

>probe:Drosophila_2:1626184_at:262:679; Interrogation_Position=123; Antisense; TAGTACCGCCCAACGCATAAATATG
>probe:Drosophila_2:1626184_at:174:377; Interrogation_Position=160; Antisense; GAAGCAGCTTGCCACTTGGGCTTAG
>probe:Drosophila_2:1626184_at:126:727; Interrogation_Position=175; Antisense; TTGGGCTTAGCCCAGACTGGATTTT
>probe:Drosophila_2:1626184_at:416:701; Interrogation_Position=217; Antisense; TTATTACTGACCGACACGATCCATA
>probe:Drosophila_2:1626184_at:558:721; Interrogation_Position=257; Antisense; TTGCATCTGGCTATGCAGTTGCCGG
>probe:Drosophila_2:1626184_at:187:721; Interrogation_Position=275; Antisense; TTGCCGGCGGTGCATTGATCAGCAT
>probe:Drosophila_2:1626184_at:219:445; Interrogation_Position=300; Antisense; GATGAGCCGCATCATATCATTGCTT
>probe:Drosophila_2:1626184_at:436:23; Interrogation_Position=313; Antisense; ATATCATTGCTTCTCCTATTCGGAA
>probe:Drosophila_2:1626184_at:142:37; Interrogation_Position=337; Antisense; ATCATTTGTGCTGCTCTAATTGCCG
>probe:Drosophila_2:1626184_at:715:307; Interrogation_Position=363; Antisense; CCATCCGCACGACCTTATTGAAGAT
>probe:Drosophila_2:1626184_at:130:351; Interrogation_Position=40; Antisense; GCAGACAAGTCCACCAGCAATTCGG
>probe:Drosophila_2:1626184_at:314:587; Interrogation_Position=461; Antisense; TGGACGAGCTGATCAGACGCTGGCA
>probe:Drosophila_2:1626184_at:24:67; Interrogation_Position=559; Antisense; ATGGATATTACCACCGAACCGGCTA
>probe:Drosophila_2:1626184_at:22:719; Interrogation_Position=84; Antisense; TTCCCCGGAGGATAATGAGCTGCAG

Paste this into a BLAST search page for me
TAGTACCGCCCAACGCATAAATATGGAAGCAGCTTGCCACTTGGGCTTAGTTGGGCTTAGCCCAGACTGGATTTTTTATTACTGACCGACACGATCCATATTGCATCTGGCTATGCAGTTGCCGGTTGCCGGCGGTGCATTGATCAGCATGATGAGCCGCATCATATCATTGCTTATATCATTGCTTCTCCTATTCGGAAATCATTTGTGCTGCTCTAATTGCCGCCATCCGCACGACCTTATTGAAGATGCAGACAAGTCCACCAGCAATTCGGTGGACGAGCTGATCAGACGCTGGCAATGGATATTACCACCGAACCGGCTATTCCCCGGAGGATAATGAGCTGCAG

Full Affymetrix probeset data:

Annotations for 1626184_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime