FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626186_at:

>probe:Drosophila_2:1626186_at:81:105; Interrogation_Position=112; Antisense; AGAAACTGTTTCTCTTTGCGCCCCT
>probe:Drosophila_2:1626186_at:376:507; Interrogation_Position=161; Antisense; GTGCAGTTTGTAAGCCCATTCGTGA
>probe:Drosophila_2:1626186_at:160:11; Interrogation_Position=178; Antisense; ATTCGTGAATTTCGCAACTCGGCTG
>probe:Drosophila_2:1626186_at:330:145; Interrogation_Position=194; Antisense; ACTCGGCTGCTTTGAAATATGCTGC
>probe:Drosophila_2:1626186_at:658:617; Interrogation_Position=222; Antisense; TGCAGCTGCAGCTCCGAAGACACGT
>probe:Drosophila_2:1626186_at:602:375; Interrogation_Position=240; Antisense; GACACGTCCTGGAAAAGTTCCTCCA
>probe:Drosophila_2:1626186_at:387:437; Interrogation_Position=279; Antisense; GAGGAAGCAATTTCAGGCGGACAAT
>probe:Drosophila_2:1626186_at:374:331; Interrogation_Position=295; Antisense; GCGGACAATGATTTGCCGATTTTTC
>probe:Drosophila_2:1626186_at:623:15; Interrogation_Position=345; Antisense; ATTATACAGACTCACCTGGGTGCTC
>probe:Drosophila_2:1626186_at:554:275; Interrogation_Position=372; Antisense; CTTCCTCGGCATAGGTGGCGATGTA
>probe:Drosophila_2:1626186_at:49:295; Interrogation_Position=390; Antisense; CGATGTATGGTTGTGGCTTGGCTAT
>probe:Drosophila_2:1626186_at:59:265; Interrogation_Position=433; Antisense; CAGAGATCATGCAAGCAAGCCCACA
>probe:Drosophila_2:1626186_at:545:195; Interrogation_Position=524; Antisense; AACGTTTCTGTACATAGGTAGTTCA
>probe:Drosophila_2:1626186_at:156:15; Interrogation_Position=66; Antisense; ATTTTGTTCCGAATACTCCAGAAAG

Paste this into a BLAST search page for me
AGAAACTGTTTCTCTTTGCGCCCCTGTGCAGTTTGTAAGCCCATTCGTGAATTCGTGAATTTCGCAACTCGGCTGACTCGGCTGCTTTGAAATATGCTGCTGCAGCTGCAGCTCCGAAGACACGTGACACGTCCTGGAAAAGTTCCTCCAGAGGAAGCAATTTCAGGCGGACAATGCGGACAATGATTTGCCGATTTTTCATTATACAGACTCACCTGGGTGCTCCTTCCTCGGCATAGGTGGCGATGTACGATGTATGGTTGTGGCTTGGCTATCAGAGATCATGCAAGCAAGCCCACAAACGTTTCTGTACATAGGTAGTTCAATTTTGTTCCGAATACTCCAGAAAG

Full Affymetrix probeset data:

Annotations for 1626186_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720