Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626187_at:

>probe:Drosophila_2:1626187_at:487:333; Interrogation_Position=2418; Antisense; GCTGGTACTCGTAGCTAGCTTCTAA
>probe:Drosophila_2:1626187_at:172:117; Interrogation_Position=2434; Antisense; AGCTTCTAATTGTTGGCGCTACCGT
>probe:Drosophila_2:1626187_at:439:323; Interrogation_Position=2460; Antisense; GCGCGCCTCCAAGTGCTGCAAATAA
>probe:Drosophila_2:1626187_at:79:61; Interrogation_Position=2502; Antisense; ATGTTTTGCACTCTGTTTTGCTTGC
>probe:Drosophila_2:1626187_at:519:71; Interrogation_Position=2543; Antisense; AGGCGGCCAGTTCAGTTCTGTTCAG
>probe:Drosophila_2:1626187_at:534:253; Interrogation_Position=2616; Antisense; CAACGCGTTGAGTGGCAAGTGCCCG
>probe:Drosophila_2:1626187_at:543:231; Interrogation_Position=2643; Antisense; AATGAGCTGTTGAGTCTGCCGGGCA
>probe:Drosophila_2:1626187_at:456:525; Interrogation_Position=2663; Antisense; GGGCACTTGTCTCTACGATTTTATA
>probe:Drosophila_2:1626187_at:653:473; Interrogation_Position=2708; Antisense; GTTAATTTACTTGCCTACGGTTCAG
>probe:Drosophila_2:1626187_at:172:219; Interrogation_Position=2734; Antisense; AAGTCAGCATCAGTGCTCCCATAAA
>probe:Drosophila_2:1626187_at:116:289; Interrogation_Position=2777; Antisense; CGGTTTCTTGGAGCTCATCTACGAG
>probe:Drosophila_2:1626187_at:277:137; Interrogation_Position=2797; Antisense; ACGAGCTGCCAATTGTGACCGTTTT
>probe:Drosophila_2:1626187_at:387:597; Interrogation_Position=2810; Antisense; TGTGACCGTTTTGCGTTCTGAACAA
>probe:Drosophila_2:1626187_at:228:389; Interrogation_Position=2839; Antisense; GAAAACTGTATTGTCTCTGTCTTAG

Paste this into a BLAST search page for me
GCTGGTACTCGTAGCTAGCTTCTAAAGCTTCTAATTGTTGGCGCTACCGTGCGCGCCTCCAAGTGCTGCAAATAAATGTTTTGCACTCTGTTTTGCTTGCAGGCGGCCAGTTCAGTTCTGTTCAGCAACGCGTTGAGTGGCAAGTGCCCGAATGAGCTGTTGAGTCTGCCGGGCAGGGCACTTGTCTCTACGATTTTATAGTTAATTTACTTGCCTACGGTTCAGAAGTCAGCATCAGTGCTCCCATAAACGGTTTCTTGGAGCTCATCTACGAGACGAGCTGCCAATTGTGACCGTTTTTGTGACCGTTTTGCGTTCTGAACAAGAAAACTGTATTGTCTCTGTCTTAG

Full Affymetrix probeset data:

Annotations for 1626187_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime