Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626191_at:

>probe:Drosophila_2:1626191_at:640:283; Interrogation_Position=3858; Antisense; CTGCTGCTTTTACATCATTGCCTAA
>probe:Drosophila_2:1626191_at:618:667; Interrogation_Position=3922; Antisense; TACTGCGCCCATACCAAAATCTTTT
>probe:Drosophila_2:1626191_at:128:91; Interrogation_Position=3958; Antisense; AGTACCAATTGTAGCTGCACCCGCT
>probe:Drosophila_2:1626191_at:484:511; Interrogation_Position=4004; Antisense; GTGAAAGTGGTACTCCCAGGCTCTT
>probe:Drosophila_2:1626191_at:117:411; Interrogation_Position=4030; Antisense; GACGCCTCTTACCAGAATGTCAGTG
>probe:Drosophila_2:1626191_at:640:367; Interrogation_Position=4044; Antisense; GAATGTCAGTGGTTTTGCCACCCTT
>probe:Drosophila_2:1626191_at:39:265; Interrogation_Position=4135; Antisense; CAGTGCTATCACAATGCCCATATCA
>probe:Drosophila_2:1626191_at:532:709; Interrogation_Position=4197; Antisense; TTAATTTGCCCTCCCACAAGATTAT
>probe:Drosophila_2:1626191_at:500:159; Interrogation_Position=4212; Antisense; ACAAGATTATCATCGCAGGCTCCGC
>probe:Drosophila_2:1626191_at:477:499; Interrogation_Position=4245; Antisense; GTCGAGTCTCGATGGCAAAGGGCAC
>probe:Drosophila_2:1626191_at:628:689; Interrogation_Position=4287; Antisense; TATTGGGATCCATCATAGCCAGCAT
>probe:Drosophila_2:1626191_at:291:241; Interrogation_Position=4337; Antisense; AATAGCAACTCCTCATCATCGACAT
>probe:Drosophila_2:1626191_at:110:187; Interrogation_Position=4369; Antisense; AACAACGAATAGTTCGCTCTCCTCT
>probe:Drosophila_2:1626191_at:24:707; Interrogation_Position=4393; Antisense; TTACGCCGGTTCCAACAATAGCTTT

Paste this into a BLAST search page for me
CTGCTGCTTTTACATCATTGCCTAATACTGCGCCCATACCAAAATCTTTTAGTACCAATTGTAGCTGCACCCGCTGTGAAAGTGGTACTCCCAGGCTCTTGACGCCTCTTACCAGAATGTCAGTGGAATGTCAGTGGTTTTGCCACCCTTCAGTGCTATCACAATGCCCATATCATTAATTTGCCCTCCCACAAGATTATACAAGATTATCATCGCAGGCTCCGCGTCGAGTCTCGATGGCAAAGGGCACTATTGGGATCCATCATAGCCAGCATAATAGCAACTCCTCATCATCGACATAACAACGAATAGTTCGCTCTCCTCTTTACGCCGGTTCCAACAATAGCTTT

Full Affymetrix probeset data:

Annotations for 1626191_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime