Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626194_at:

>probe:Drosophila_2:1626194_at:40:475; Interrogation_Position=3185; Antisense; GTTACCAGTCAGTTTCCTCAGGTTA
>probe:Drosophila_2:1626194_at:374:651; Interrogation_Position=3241; Antisense; TCACTCGGGCTTTCTGGATGTGTTC
>probe:Drosophila_2:1626194_at:592:547; Interrogation_Position=3256; Antisense; GGATGTGTTCGAGGTCTCCAAGACA
>probe:Drosophila_2:1626194_at:488:105; Interrogation_Position=3280; Antisense; AGACAAGTCCAACCCAAACTGCAAT
>probe:Drosophila_2:1626194_at:301:719; Interrogation_Position=3329; Antisense; TTCCTCTGCAATCATCCGGACAAGG
>probe:Drosophila_2:1626194_at:653:225; Interrogation_Position=3350; Antisense; AAGGCGGTGGGCTTTCTCAATGGCA
>probe:Drosophila_2:1626194_at:526:583; Interrogation_Position=3370; Antisense; TGGCAGCAATCAGCCCATGATCGAG
>probe:Drosophila_2:1626194_at:709:581; Interrogation_Position=3422; Antisense; TGGCGACTATTCAGGCGCTGGCGAA
>probe:Drosophila_2:1626194_at:524:667; Interrogation_Position=3452; Antisense; TACTTCACTTTGTCCGGAGCGCACT
>probe:Drosophila_2:1626194_at:280:553; Interrogation_Position=3467; Antisense; GGAGCGCACTTGTCCTGCAAAGGCT
>probe:Drosophila_2:1626194_at:446:663; Interrogation_Position=3534; Antisense; TAAAGGTATCTCGTGGTGCCCGTAA
>probe:Drosophila_2:1626194_at:534:301; Interrogation_Position=3585; Antisense; CCGCCGACCAGACATTAATACTCAA
>probe:Drosophila_2:1626194_at:405:85; Interrogation_Position=3645; Antisense; AGTGCCTCAGCATCGTGGTAGCCCA
>probe:Drosophila_2:1626194_at:538:427; Interrogation_Position=3681; Antisense; GAGATAATCCCACGGCCAAGACGAA

Paste this into a BLAST search page for me
GTTACCAGTCAGTTTCCTCAGGTTATCACTCGGGCTTTCTGGATGTGTTCGGATGTGTTCGAGGTCTCCAAGACAAGACAAGTCCAACCCAAACTGCAATTTCCTCTGCAATCATCCGGACAAGGAAGGCGGTGGGCTTTCTCAATGGCATGGCAGCAATCAGCCCATGATCGAGTGGCGACTATTCAGGCGCTGGCGAATACTTCACTTTGTCCGGAGCGCACTGGAGCGCACTTGTCCTGCAAAGGCTTAAAGGTATCTCGTGGTGCCCGTAACCGCCGACCAGACATTAATACTCAAAGTGCCTCAGCATCGTGGTAGCCCAGAGATAATCCCACGGCCAAGACGAA

Full Affymetrix probeset data:

Annotations for 1626194_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime