FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626195_at:

>probe:Drosophila_2:1626195_at:249:19; Interrogation_Position=275; Antisense; ATATCCTTCGTACGACGCCGAAAGC
>probe:Drosophila_2:1626195_at:632:207; Interrogation_Position=296; Antisense; AAGCTGCACTACACTGAGTTCTCAA
>probe:Drosophila_2:1626195_at:21:93; Interrogation_Position=312; Antisense; AGTTCTCAACGGTCGAGTTGGCCAG
>probe:Drosophila_2:1626195_at:556:95; Interrogation_Position=327; Antisense; AGTTGGCCAGGCGTCTGATCCGCGA
>probe:Drosophila_2:1626195_at:562:473; Interrogation_Position=355; Antisense; GTTCACAGAGTCATCGGAGAGTCAA
>probe:Drosophila_2:1626195_at:88:97; Interrogation_Position=408; Antisense; AGATCGCCGAAGAGGAGTGTCCGCC
>probe:Drosophila_2:1626195_at:715:487; Interrogation_Position=463; Antisense; GTACTTCCAATACGATCGGGCTACA
>probe:Drosophila_2:1626195_at:103:291; Interrogation_Position=479; Antisense; CGGGCTACAGACCAATCGATGATTT
>probe:Drosophila_2:1626195_at:303:59; Interrogation_Position=497; Antisense; ATGATTTCCGACGACAGTCTGCCAA
>probe:Drosophila_2:1626195_at:440:633; Interrogation_Position=547; Antisense; TCCCGCCCATCATTGCTATAATAAG
>probe:Drosophila_2:1626195_at:261:117; Interrogation_Position=570; Antisense; AGCTTATAAGCCAGACTCCTGATCC
>probe:Drosophila_2:1626195_at:517:603; Interrogation_Position=589; Antisense; TGATCCGCCGATAGTGTACGTTCCC
>probe:Drosophila_2:1626195_at:32:311; Interrogation_Position=710; Antisense; CCAACTGCTCCGGAAGTCATTGATA
>probe:Drosophila_2:1626195_at:588:529; Interrogation_Position=765; Antisense; GGGTCCTTGACCGTGGCGAAAATAT

Paste this into a BLAST search page for me
ATATCCTTCGTACGACGCCGAAAGCAAGCTGCACTACACTGAGTTCTCAAAGTTCTCAACGGTCGAGTTGGCCAGAGTTGGCCAGGCGTCTGATCCGCGAGTTCACAGAGTCATCGGAGAGTCAAAGATCGCCGAAGAGGAGTGTCCGCCGTACTTCCAATACGATCGGGCTACACGGGCTACAGACCAATCGATGATTTATGATTTCCGACGACAGTCTGCCAATCCCGCCCATCATTGCTATAATAAGAGCTTATAAGCCAGACTCCTGATCCTGATCCGCCGATAGTGTACGTTCCCCCAACTGCTCCGGAAGTCATTGATAGGGTCCTTGACCGTGGCGAAAATAT

Full Affymetrix probeset data:

Annotations for 1626195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720