FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626196_at:

>probe:Drosophila_2:1626196_at:671:351; Interrogation_Position=1171; Antisense; GCACCCTGGGCGAGAAGTTCAAGCA
>probe:Drosophila_2:1626196_at:54:467; Interrogation_Position=1235; Antisense; GTTGGCCCTGGAAGAGTCGCTCGAA
>probe:Drosophila_2:1626196_at:611:635; Interrogation_Position=1255; Antisense; TCGAAGTGGGCGGATTCGGCTATCC
>probe:Drosophila_2:1626196_at:722:307; Interrogation_Position=1282; Antisense; CCATGGCTGTGGTCAACTTCAAGAA
>probe:Drosophila_2:1626196_at:606:55; Interrogation_Position=1308; Antisense; ATGAAATTCTCCGTGCTCAAGGGCT
>probe:Drosophila_2:1626196_at:29:219; Interrogation_Position=1326; Antisense; AAGGGCTCCTTCTCCAAGGACGGCA
>probe:Drosophila_2:1626196_at:24:143; Interrogation_Position=1392; Antisense; ACGGCGCCTGTTCGCGGAGCCAAAA
>probe:Drosophila_2:1626196_at:78:173; Interrogation_Position=1415; Antisense; AAAGCCGGCGATTGTGTCCGTGGAT
>probe:Drosophila_2:1626196_at:22:503; Interrogation_Position=1430; Antisense; GTCCGTGGATCCTTGGGACGGCAAA
>probe:Drosophila_2:1626196_at:494:39; Interrogation_Position=1486; Antisense; ATCTGAGCGACATCGATCTGGATAA
>probe:Drosophila_2:1626196_at:414:395; Interrogation_Position=1538; Antisense; GAAATCAAGACTGTGCGGCCCAAGC
>probe:Drosophila_2:1626196_at:618:321; Interrogation_Position=1555; Antisense; GCCCAAGCTCAAATTTCCACTTATT
>probe:Drosophila_2:1626196_at:273:459; Interrogation_Position=1607; Antisense; GATATTCATTAGTCAGCCATCGTAT
>probe:Drosophila_2:1626196_at:638:115; Interrogation_Position=1662; Antisense; AGCGTTTTTCTACAATCCTCACATA

Paste this into a BLAST search page for me
GCACCCTGGGCGAGAAGTTCAAGCAGTTGGCCCTGGAAGAGTCGCTCGAATCGAAGTGGGCGGATTCGGCTATCCCCATGGCTGTGGTCAACTTCAAGAAATGAAATTCTCCGTGCTCAAGGGCTAAGGGCTCCTTCTCCAAGGACGGCAACGGCGCCTGTTCGCGGAGCCAAAAAAAGCCGGCGATTGTGTCCGTGGATGTCCGTGGATCCTTGGGACGGCAAAATCTGAGCGACATCGATCTGGATAAGAAATCAAGACTGTGCGGCCCAAGCGCCCAAGCTCAAATTTCCACTTATTGATATTCATTAGTCAGCCATCGTATAGCGTTTTTCTACAATCCTCACATA

Full Affymetrix probeset data:

Annotations for 1626196_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720