FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626197_at:

>probe:Drosophila_2:1626197_at:185:349; Interrogation_Position=1125; Antisense; GCAGTTCGGTTCTCAAACTTTTCGG
>probe:Drosophila_2:1626197_at:130:553; Interrogation_Position=1148; Antisense; GGAGCAATACGACCCATATCATATC
>probe:Drosophila_2:1626197_at:476:35; Interrogation_Position=1173; Antisense; ATCAGACGAAACCACCTGGACATTC
>probe:Drosophila_2:1626197_at:683:691; Interrogation_Position=1227; Antisense; TTTGGCGAGAGTTACGAGCACTTTT
>probe:Drosophila_2:1626197_at:510:421; Interrogation_Position=1242; Antisense; GAGCACTTTTACGAGATCTTTCACT
>probe:Drosophila_2:1626197_at:4:35; Interrogation_Position=1257; Antisense; ATCTTTCACTTTTTCGAGCCAGTCA
>probe:Drosophila_2:1626197_at:631:265; Interrogation_Position=1276; Antisense; CAGTCACCCATTCACATATCTGCAA
>probe:Drosophila_2:1626197_at:306:551; Interrogation_Position=1313; Antisense; GGAGATCAACATAGCGTTCTTTCGG
>probe:Drosophila_2:1626197_at:242:249; Interrogation_Position=1381; Antisense; AATTGGCCACCGCATATGAGGGACA
>probe:Drosophila_2:1626197_at:367:221; Interrogation_Position=1458; Antisense; AAGGTGGACTACTTTGAGTCGCCTC
>probe:Drosophila_2:1626197_at:168:431; Interrogation_Position=1473; Antisense; GAGTCGCCTCGTGTGAGTGACGTTA
>probe:Drosophila_2:1626197_at:536:237; Interrogation_Position=1569; Antisense; AATCATGCATTGTTGGTTGCGATTT
>probe:Drosophila_2:1626197_at:239:509; Interrogation_Position=1595; Antisense; GTGCAAGAATACTACCTTACTTTTG
>probe:Drosophila_2:1626197_at:482:687; Interrogation_Position=1648; Antisense; TATATATTTCCAACCTGTCTACATA

Paste this into a BLAST search page for me
GCAGTTCGGTTCTCAAACTTTTCGGGGAGCAATACGACCCATATCATATCATCAGACGAAACCACCTGGACATTCTTTGGCGAGAGTTACGAGCACTTTTGAGCACTTTTACGAGATCTTTCACTATCTTTCACTTTTTCGAGCCAGTCACAGTCACCCATTCACATATCTGCAAGGAGATCAACATAGCGTTCTTTCGGAATTGGCCACCGCATATGAGGGACAAAGGTGGACTACTTTGAGTCGCCTCGAGTCGCCTCGTGTGAGTGACGTTAAATCATGCATTGTTGGTTGCGATTTGTGCAAGAATACTACCTTACTTTTGTATATATTTCCAACCTGTCTACATA

Full Affymetrix probeset data:

Annotations for 1626197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720