FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626198_at:

>probe:Drosophila_2:1626198_at:646:75; Interrogation_Position=1016; Antisense; AGGAGATCGTTCAGGTGCTCGGCAC
>probe:Drosophila_2:1626198_at:49:209; Interrogation_Position=1047; Antisense; AAGCAGACCGGTTAGCATTCGTGAC
>probe:Drosophila_2:1626198_at:718:607; Interrogation_Position=1115; Antisense; TGAGGATGTATCCACCAGTGCCCAT
>probe:Drosophila_2:1626198_at:104:577; Interrogation_Position=1145; Antisense; GGCGCAAATTGCAGACCGACTTCAA
>probe:Drosophila_2:1626198_at:198:165; Interrogation_Position=1168; Antisense; AAATACACCCATTCCGTGCATGGAG
>probe:Drosophila_2:1626198_at:722:491; Interrogation_Position=1198; Antisense; GTAATTCCGGCTGGCTCAGAGATTA
>probe:Drosophila_2:1626198_at:719:237; Interrogation_Position=1224; Antisense; AATCGGAATCTTTGGTGTACATCGC
>probe:Drosophila_2:1626198_at:96:599; Interrogation_Position=1239; Antisense; TGTACATCGCCAACCAGAAACCTTT
>probe:Drosophila_2:1626198_at:122:365; Interrogation_Position=1276; Antisense; GAATTTATCCCTGAACGACATGAGA
>probe:Drosophila_2:1626198_at:639:369; Interrogation_Position=1304; Antisense; GAAGTCGCGTGGCTCCATTTAAAAT
>probe:Drosophila_2:1626198_at:246:9; Interrogation_Position=1330; Antisense; ATTCCATTCAGTGCAGGACCCAGGA
>probe:Drosophila_2:1626198_at:440:679; Interrogation_Position=1361; Antisense; TAGGTCAGAAGTTCGCTCAGCTGGA
>probe:Drosophila_2:1626198_at:96:27; Interrogation_Position=1419; Antisense; ATACGAACTGCTTCCGATGGGTCAA
>probe:Drosophila_2:1626198_at:77:105; Interrogation_Position=1481; Antisense; AAACGGGTTTTCAGCTGGGAATGCG

Paste this into a BLAST search page for me
AGGAGATCGTTCAGGTGCTCGGCACAAGCAGACCGGTTAGCATTCGTGACTGAGGATGTATCCACCAGTGCCCATGGCGCAAATTGCAGACCGACTTCAAAAATACACCCATTCCGTGCATGGAGGTAATTCCGGCTGGCTCAGAGATTAAATCGGAATCTTTGGTGTACATCGCTGTACATCGCCAACCAGAAACCTTTGAATTTATCCCTGAACGACATGAGAGAAGTCGCGTGGCTCCATTTAAAATATTCCATTCAGTGCAGGACCCAGGATAGGTCAGAAGTTCGCTCAGCTGGAATACGAACTGCTTCCGATGGGTCAAAAACGGGTTTTCAGCTGGGAATGCG

Full Affymetrix probeset data:

Annotations for 1626198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720