FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626199_at:

>probe:Drosophila_2:1626199_at:40:407; Interrogation_Position=1023; Antisense; GACTGGAAGCCACTTAACTATACGA
>probe:Drosophila_2:1626199_at:104:331; Interrogation_Position=1106; Antisense; GCGGAACGCGCTTTGTATGATACTT
>probe:Drosophila_2:1626199_at:615:129; Interrogation_Position=660; Antisense; ACCTCCTCTAGTCACAACCAAATTG
>probe:Drosophila_2:1626199_at:350:249; Interrogation_Position=680; Antisense; AATTGGAGTCTGTCGAGGATCTGCA
>probe:Drosophila_2:1626199_at:48:359; Interrogation_Position=702; Antisense; GCAACAGTCGGTGGATGCCCAGCAG
>probe:Drosophila_2:1626199_at:5:455; Interrogation_Position=739; Antisense; GATCAGATACAGCTCCTCACCGAAG
>probe:Drosophila_2:1626199_at:472:527; Interrogation_Position=788; Antisense; GGGAACAGTGCAATAAGCCAGCTAT
>probe:Drosophila_2:1626199_at:328:659; Interrogation_Position=801; Antisense; TAAGCCAGCTATCATAAATCCGGAC
>probe:Drosophila_2:1626199_at:501:349; Interrogation_Position=842; Antisense; GCAGCAACGAGTGCGTCGTCATCCA
>probe:Drosophila_2:1626199_at:349:289; Interrogation_Position=871; Antisense; CGGAATGTATTCAACCACTGGGTAA
>probe:Drosophila_2:1626199_at:34:685; Interrogation_Position=896; Antisense; TATCCATGAACTCATAGCTGCCACC
>probe:Drosophila_2:1626199_at:373:313; Interrogation_Position=915; Antisense; GCCACCCGCTACGTCGAATGTAGAT
>probe:Drosophila_2:1626199_at:456:663; Interrogation_Position=941; Antisense; TAAACTCGTTGCATACGCTGCACAG
>probe:Drosophila_2:1626199_at:729:319; Interrogation_Position=980; Antisense; GCCCACATTCGGCATGCTGAACGAA

Paste this into a BLAST search page for me
GACTGGAAGCCACTTAACTATACGAGCGGAACGCGCTTTGTATGATACTTACCTCCTCTAGTCACAACCAAATTGAATTGGAGTCTGTCGAGGATCTGCAGCAACAGTCGGTGGATGCCCAGCAGGATCAGATACAGCTCCTCACCGAAGGGGAACAGTGCAATAAGCCAGCTATTAAGCCAGCTATCATAAATCCGGACGCAGCAACGAGTGCGTCGTCATCCACGGAATGTATTCAACCACTGGGTAATATCCATGAACTCATAGCTGCCACCGCCACCCGCTACGTCGAATGTAGATTAAACTCGTTGCATACGCTGCACAGGCCCACATTCGGCATGCTGAACGAA

Full Affymetrix probeset data:

Annotations for 1626199_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720