FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626201_at:

>probe:Drosophila_2:1626201_at:316:19; Interrogation_Position=1018; Antisense; ATTTCCGGCAGTTCGATTTTGGCAC
>probe:Drosophila_2:1626201_at:167:563; Interrogation_Position=1070; Antisense; GGAAGCCCCAGAGGATTACCCAACT
>probe:Drosophila_2:1626201_at:455:99; Interrogation_Position=1141; Antisense; AGATGGCCGCAGTTGAGGATGTCCT
>probe:Drosophila_2:1626201_at:343:529; Interrogation_Position=1222; Antisense; GGGATCATATGGACTTCGCTCTCAA
>probe:Drosophila_2:1626201_at:234:339; Interrogation_Position=1239; Antisense; GCTCTCAACTGGGAGGTGCGCCAAT
>probe:Drosophila_2:1626201_at:383:449; Interrogation_Position=1272; Antisense; GATCCGATTGTAGCCATTCTAAACG
>probe:Drosophila_2:1626201_at:595:59; Interrogation_Position=733; Antisense; ATGTTATGGTCAACACCTTGTCTCC
>probe:Drosophila_2:1626201_at:693:411; Interrogation_Position=785; Antisense; GACCCTCTTCTGTTCTCAAGAATTC
>probe:Drosophila_2:1626201_at:184:199; Interrogation_Position=819; Antisense; AACGATTTCGTCCTGGCTCTGATGT
>probe:Drosophila_2:1626201_at:496:665; Interrogation_Position=843; Antisense; TACAGTGTTTGTCTTCCGGAATCGA
>probe:Drosophila_2:1626201_at:56:563; Interrogation_Position=915; Antisense; GGAAGAACTAATTCGACCGCCTCTG
>probe:Drosophila_2:1626201_at:249:467; Interrogation_Position=941; Antisense; GTTGACTTCTGGAGTGATGCCTGCT
>probe:Drosophila_2:1626201_at:666:283; Interrogation_Position=961; Antisense; CTGCTGGTGTTTCCACGGATCAAAT
>probe:Drosophila_2:1626201_at:609:617; Interrogation_Position=997; Antisense; TGCAGGAGCATCAATCGGGACATTT

Paste this into a BLAST search page for me
ATTTCCGGCAGTTCGATTTTGGCACGGAAGCCCCAGAGGATTACCCAACTAGATGGCCGCAGTTGAGGATGTCCTGGGATCATATGGACTTCGCTCTCAAGCTCTCAACTGGGAGGTGCGCCAATGATCCGATTGTAGCCATTCTAAACGATGTTATGGTCAACACCTTGTCTCCGACCCTCTTCTGTTCTCAAGAATTCAACGATTTCGTCCTGGCTCTGATGTTACAGTGTTTGTCTTCCGGAATCGAGGAAGAACTAATTCGACCGCCTCTGGTTGACTTCTGGAGTGATGCCTGCTCTGCTGGTGTTTCCACGGATCAAATTGCAGGAGCATCAATCGGGACATTT

Full Affymetrix probeset data:

Annotations for 1626201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720