FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626203_at:

>probe:Drosophila_2:1626203_at:694:79; Interrogation_Position=1027; Antisense; AGGTGCTGCTAACAACGCGATGCGC
>probe:Drosophila_2:1626203_at:656:383; Interrogation_Position=566; Antisense; GAACTTTAGAATTGCCACTGTCCAT
>probe:Drosophila_2:1626203_at:596:721; Interrogation_Position=577; Antisense; TTGCCACTGTCCATGTTTCAACAAG
>probe:Drosophila_2:1626203_at:623:507; Interrogation_Position=601; Antisense; GTGCGCTATAATATTGCTCTCTTAC
>probe:Drosophila_2:1626203_at:18:357; Interrogation_Position=645; Antisense; GCAAACTGCCACTTTCACTTTTAAA
>probe:Drosophila_2:1626203_at:287:103; Interrogation_Position=678; Antisense; AGAGCCATCCCATGTTGGTGGAGCT
>probe:Drosophila_2:1626203_at:123:65; Interrogation_Position=723; Antisense; ATGGTCACCTGGTTAGTTGCGACTC
>probe:Drosophila_2:1626203_at:243:39; Interrogation_Position=762; Antisense; ATCTGCGCGATGTTATTTGCACCTC
>probe:Drosophila_2:1626203_at:604:67; Interrogation_Position=792; Antisense; ATGGCGATCGGTTTTGGCGCATGCC
>probe:Drosophila_2:1626203_at:249:577; Interrogation_Position=807; Antisense; GGCGCATGCCCGAATGTTATATCCG
>probe:Drosophila_2:1626203_at:125:683; Interrogation_Position=826; Antisense; TATCCGCGGGAGCACCATCAAATAT
>probe:Drosophila_2:1626203_at:551:163; Interrogation_Position=845; Antisense; AAATATCTGCGAATCCCCGACGAAG
>probe:Drosophila_2:1626203_at:377:425; Interrogation_Position=920; Antisense; GAGATGAACAAAAACCGCGGCGGCA
>probe:Drosophila_2:1626203_at:35:331; Interrogation_Position=981; Antisense; GCGGCAACCGCAACAATGTCGGCAA

Paste this into a BLAST search page for me
AGGTGCTGCTAACAACGCGATGCGCGAACTTTAGAATTGCCACTGTCCATTTGCCACTGTCCATGTTTCAACAAGGTGCGCTATAATATTGCTCTCTTACGCAAACTGCCACTTTCACTTTTAAAAGAGCCATCCCATGTTGGTGGAGCTATGGTCACCTGGTTAGTTGCGACTCATCTGCGCGATGTTATTTGCACCTCATGGCGATCGGTTTTGGCGCATGCCGGCGCATGCCCGAATGTTATATCCGTATCCGCGGGAGCACCATCAAATATAAATATCTGCGAATCCCCGACGAAGGAGATGAACAAAAACCGCGGCGGCAGCGGCAACCGCAACAATGTCGGCAA

Full Affymetrix probeset data:

Annotations for 1626203_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720