Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626209_a_at:

>probe:Drosophila_2:1626209_a_at:66:211; Interrogation_Position=163; Antisense; AAGAATGAGTTGCTCAGCCTGCGCG
>probe:Drosophila_2:1626209_a_at:253:647; Interrogation_Position=176; Antisense; TCAGCCTGCGCGTGGCCAAGGTGAC
>probe:Drosophila_2:1626209_a_at:24:213; Interrogation_Position=226; Antisense; AAGATCCGCGTTGTCCGCAAGGCCA
>probe:Drosophila_2:1626209_a_at:390:43; Interrogation_Position=250; Antisense; ATCGCTCGCGTCTACATTGTGATGC
>probe:Drosophila_2:1626209_a_at:17:423; Interrogation_Position=289; Antisense; GAGAATCTGCGCAAGGTCTTCAAGA
>probe:Drosophila_2:1626209_a_at:88:219; Interrogation_Position=319; Antisense; AAGTACAAGCCCCTGGATCTGCGCA
>probe:Drosophila_2:1626209_a_at:383:359; Interrogation_Position=341; Antisense; GCAAGAAGAAGACCCGCGCTATCCG
>probe:Drosophila_2:1626209_a_at:47:311; Interrogation_Position=389; Antisense; CCAACCGCAAGACCCTCAAGGAGAT
>probe:Drosophila_2:1626209_a_at:147:225; Interrogation_Position=406; Antisense; AAGGAGATCCGCAAGCGCTCCGTCT
>probe:Drosophila_2:1626209_a_at:690:561; Interrogation_Position=440; Antisense; GGAAGTTCGCCGTCAAGGCCTAGAA
>probe:Drosophila_2:1626209_a_at:128:677; Interrogation_Position=460; Antisense; TAGAATGCATCCAGATACTCCGACT
>probe:Drosophila_2:1626209_a_at:50:633; Interrogation_Position=478; Antisense; TCCGACTGTCTATAGTGCGCGTTAA
>probe:Drosophila_2:1626209_a_at:274:595; Interrogation_Position=493; Antisense; TGCGCGTTAAGGGTTCTTCGGTACA
>probe:Drosophila_2:1626209_a_at:52:511; Interrogation_Position=94; Antisense; GTGAAGGTTAAGTGCTCCGAGCTGA

Paste this into a BLAST search page for me
AAGAATGAGTTGCTCAGCCTGCGCGTCAGCCTGCGCGTGGCCAAGGTGACAAGATCCGCGTTGTCCGCAAGGCCAATCGCTCGCGTCTACATTGTGATGCGAGAATCTGCGCAAGGTCTTCAAGAAAGTACAAGCCCCTGGATCTGCGCAGCAAGAAGAAGACCCGCGCTATCCGCCAACCGCAAGACCCTCAAGGAGATAAGGAGATCCGCAAGCGCTCCGTCTGGAAGTTCGCCGTCAAGGCCTAGAATAGAATGCATCCAGATACTCCGACTTCCGACTGTCTATAGTGCGCGTTAATGCGCGTTAAGGGTTCTTCGGTACAGTGAAGGTTAAGTGCTCCGAGCTGA

Full Affymetrix probeset data:

Annotations for 1626209_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime