FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626210_at:

>probe:Drosophila_2:1626210_at:329:573; Interrogation_Position=180; Antisense; GGCTCGAGAAGAAACCCCGAACAGT
>probe:Drosophila_2:1626210_at:516:389; Interrogation_Position=190; Antisense; GAAACCCCGAACAGTGAACACCAAG
>probe:Drosophila_2:1626210_at:548:613; Interrogation_Position=204; Antisense; TGAACACCAAGCACCAGAGGCCAGA
>probe:Drosophila_2:1626210_at:188:397; Interrogation_Position=21; Antisense; GAAATTCAATTCGAGGCCGCAGAGA
>probe:Drosophila_2:1626210_at:68:355; Interrogation_Position=214; Antisense; GCACCAGAGGCCAGAGACGCAGACT
>probe:Drosophila_2:1626210_at:707:287; Interrogation_Position=240; Antisense; CGGCAGCGAGCTATGCGGGTTCAAA
>probe:Drosophila_2:1626210_at:162:279; Interrogation_Position=250; Antisense; CTATGCGGGTTCAAATGCGGCCAGC
>probe:Drosophila_2:1626210_at:175:623; Interrogation_Position=265; Antisense; TGCGGCCAGCATGACGAATTATTAC
>probe:Drosophila_2:1626210_at:161:363; Interrogation_Position=280; Antisense; GAATTATTACACACAGTCTCGCGAC
>probe:Drosophila_2:1626210_at:91:297; Interrogation_Position=38; Antisense; CGCAGAGAGCGATCGAATCCGGCAA
>probe:Drosophila_2:1626210_at:158:449; Interrogation_Position=48; Antisense; GATCGAATCCGGCAAGCAAACTAAG
>probe:Drosophila_2:1626210_at:513:105; Interrogation_Position=73; Antisense; AGAACAGTTAAGAGAGGCGCGCATT
>probe:Drosophila_2:1626210_at:672:213; Interrogation_Position=82; Antisense; AAGAGAGGCGCGCATTATCTCGCTG
>probe:Drosophila_2:1626210_at:173:685; Interrogation_Position=97; Antisense; TATCTCGCTGCCTTGCAAATTAGGG

Paste this into a BLAST search page for me
GGCTCGAGAAGAAACCCCGAACAGTGAAACCCCGAACAGTGAACACCAAGTGAACACCAAGCACCAGAGGCCAGAGAAATTCAATTCGAGGCCGCAGAGAGCACCAGAGGCCAGAGACGCAGACTCGGCAGCGAGCTATGCGGGTTCAAACTATGCGGGTTCAAATGCGGCCAGCTGCGGCCAGCATGACGAATTATTACGAATTATTACACACAGTCTCGCGACCGCAGAGAGCGATCGAATCCGGCAAGATCGAATCCGGCAAGCAAACTAAGAGAACAGTTAAGAGAGGCGCGCATTAAGAGAGGCGCGCATTATCTCGCTGTATCTCGCTGCCTTGCAAATTAGGG

Full Affymetrix probeset data:

Annotations for 1626210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720