FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626211_at:

>probe:Drosophila_2:1626211_at:447:603; Interrogation_Position=113; Antisense; TGTTGTGCAAACAGTTCACGCCCGA
>probe:Drosophila_2:1626211_at:617:89; Interrogation_Position=125; Antisense; AGTTCACGCCCGACTTCAACGAGGA
>probe:Drosophila_2:1626211_at:87:705; Interrogation_Position=154; Antisense; TTATGCAGCATCACCAAGGATTCGC
>probe:Drosophila_2:1626211_at:92:225; Interrogation_Position=169; Antisense; AAGGATTCGCAGGACATTGCCGTGC
>probe:Drosophila_2:1626211_at:20:723; Interrogation_Position=185; Antisense; TTGCCGTGCTTCTGGCCGAGATGCA
>probe:Drosophila_2:1626211_at:186:165; Interrogation_Position=20; Antisense; AAATAAATGCGGCTTCCGCTCTCTG
>probe:Drosophila_2:1626211_at:311:483; Interrogation_Position=213; Antisense; GTATATGCCGCAGCACGAGGCGTAC
>probe:Drosophila_2:1626211_at:90:201; Interrogation_Position=247; Antisense; AACGCGGCGCTGGACACAACTGGAC
>probe:Drosophila_2:1626211_at:598:157; Interrogation_Position=260; Antisense; ACACAACTGGACCTTGGCAGGCCAA
>probe:Drosophila_2:1626211_at:690:67; Interrogation_Position=278; Antisense; AGGCCAAGCGGCGTCAGAACTACAT
>probe:Drosophila_2:1626211_at:431:641; Interrogation_Position=302; Antisense; TCTGCAAGAACATGAGCCTGCTCTG
>probe:Drosophila_2:1626211_at:690:179; Interrogation_Position=55; Antisense; AAACAACATGAGAACCGAGCCGGTC
>probe:Drosophila_2:1626211_at:75:537; Interrogation_Position=76; Antisense; GGTCCCTCGAACCTGGGCAATGTCA
>probe:Drosophila_2:1626211_at:434:497; Interrogation_Position=97; Antisense; GTCATCAGCCAGATATTGTTGTGCA

Paste this into a BLAST search page for me
TGTTGTGCAAACAGTTCACGCCCGAAGTTCACGCCCGACTTCAACGAGGATTATGCAGCATCACCAAGGATTCGCAAGGATTCGCAGGACATTGCCGTGCTTGCCGTGCTTCTGGCCGAGATGCAAAATAAATGCGGCTTCCGCTCTCTGGTATATGCCGCAGCACGAGGCGTACAACGCGGCGCTGGACACAACTGGACACACAACTGGACCTTGGCAGGCCAAAGGCCAAGCGGCGTCAGAACTACATTCTGCAAGAACATGAGCCTGCTCTGAAACAACATGAGAACCGAGCCGGTCGGTCCCTCGAACCTGGGCAATGTCAGTCATCAGCCAGATATTGTTGTGCA

Full Affymetrix probeset data:

Annotations for 1626211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720