Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626214_s_at:

>probe:Drosophila_2:1626214_s_at:402:663; Interrogation_Position=122; Antisense; TAAAGCGTGTCAAATTTCGTACCAA
>probe:Drosophila_2:1626214_s_at:419:495; Interrogation_Position=130; Antisense; GTCAAATTTCGTACCAATCTGGAGC
>probe:Drosophila_2:1626214_s_at:179:697; Interrogation_Position=136; Antisense; TTTCGTACCAATCTGGAGCACGAGT
>probe:Drosophila_2:1626214_s_at:454:191; Interrogation_Position=169; Antisense; AACTTCAAGATATTGCAGGCGGGCT
>probe:Drosophila_2:1626214_s_at:667:707; Interrogation_Position=181; Antisense; TTGCAGGCGGGCTTCAAGAAGATGT
>probe:Drosophila_2:1626214_s_at:64:249; Interrogation_Position=300; Antisense; CAATTACGATGGCAGGGATTACGAT
>probe:Drosophila_2:1626214_s_at:514:13; Interrogation_Position=317; Antisense; ATTACGATGCCAGCGCGGTGCGCGA
>probe:Drosophila_2:1626214_s_at:65:81; Interrogation_Position=341; Antisense; AGGGAGCCCCAATGGGCTTCGGATC
>probe:Drosophila_2:1626214_s_at:454:273; Interrogation_Position=357; Antisense; CTTCGGATCGGGAGCGGTAAAGTCA
>probe:Drosophila_2:1626214_s_at:58:555; Interrogation_Position=367; Antisense; GGAGCGGTAAAGTCACTGCCCGGCA
>probe:Drosophila_2:1626214_s_at:327:113; Interrogation_Position=412; Antisense; AGCAGCTATCGACGTGGCCCATCGG
>probe:Drosophila_2:1626214_s_at:641:507; Interrogation_Position=487; Antisense; GTGCTGCCGCGCACGAACAACGCAG
>probe:Drosophila_2:1626214_s_at:588:351; Interrogation_Position=508; Antisense; GCAGCCCCAGCGAGCAGAATAAACG
>probe:Drosophila_2:1626214_s_at:458:165; Interrogation_Position=58; Antisense; AAATCGAGGAGCTCTGCACAGGTGC

Paste this into a BLAST search page for me
TAAAGCGTGTCAAATTTCGTACCAAGTCAAATTTCGTACCAATCTGGAGCTTTCGTACCAATCTGGAGCACGAGTAACTTCAAGATATTGCAGGCGGGCTTTGCAGGCGGGCTTCAAGAAGATGTCAATTACGATGGCAGGGATTACGATATTACGATGCCAGCGCGGTGCGCGAAGGGAGCCCCAATGGGCTTCGGATCCTTCGGATCGGGAGCGGTAAAGTCAGGAGCGGTAAAGTCACTGCCCGGCAAGCAGCTATCGACGTGGCCCATCGGGTGCTGCCGCGCACGAACAACGCAGGCAGCCCCAGCGAGCAGAATAAACGAAATCGAGGAGCTCTGCACAGGTGC

Full Affymetrix probeset data:

Annotations for 1626214_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime