FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626215_at:

>probe:Drosophila_2:1626215_at:595:507; Interrogation_Position=2586; Antisense; GTGCTGAGAGCACATCGTCGACCAC
>probe:Drosophila_2:1626215_at:617:711; Interrogation_Position=2616; Antisense; TTCACTCGCCGGGTACATACAATGC
>probe:Drosophila_2:1626215_at:2:119; Interrogation_Position=2650; Antisense; AGCTCCAGCTAATACCTTCGATGGA
>probe:Drosophila_2:1626215_at:292:439; Interrogation_Position=2669; Antisense; GATGGAGCCAACTTTACACCCACGG
>probe:Drosophila_2:1626215_at:108:83; Interrogation_Position=2695; Antisense; AGTGAATACGCCTGCTCCGTTTGGC
>probe:Drosophila_2:1626215_at:281:473; Interrogation_Position=2741; Antisense; GTTATGGCGCATCTCATGTACAACC
>probe:Drosophila_2:1626215_at:342:285; Interrogation_Position=2825; Antisense; CTGAAGTGCGTGATTCTGCTACTGC
>probe:Drosophila_2:1626215_at:532:403; Interrogation_Position=2913; Antisense; GACTTAAGCTTTCCTCTGTACATAA
>probe:Drosophila_2:1626215_at:464:3; Interrogation_Position=2949; Antisense; ATTGGGAGGAGCTGTTGCACCGCAC
>probe:Drosophila_2:1626215_at:599:521; Interrogation_Position=2975; Antisense; GGGCTCTGGCCAATTGAAGGGTTCA
>probe:Drosophila_2:1626215_at:217:373; Interrogation_Position=2990; Antisense; GAAGGGTTCATCACTGGCGCAGGCA
>probe:Drosophila_2:1626215_at:656:139; Interrogation_Position=3019; Antisense; ACGTGCCGCCCATTTTAATGTGTTA
>probe:Drosophila_2:1626215_at:62:385; Interrogation_Position=3067; Antisense; GAACTGCTCTACTACAGTGTAGGCG
>probe:Drosophila_2:1626215_at:510:173; Interrogation_Position=3108; Antisense; AAAGCTTGCATCAGTGCGATTGTAT

Paste this into a BLAST search page for me
GTGCTGAGAGCACATCGTCGACCACTTCACTCGCCGGGTACATACAATGCAGCTCCAGCTAATACCTTCGATGGAGATGGAGCCAACTTTACACCCACGGAGTGAATACGCCTGCTCCGTTTGGCGTTATGGCGCATCTCATGTACAACCCTGAAGTGCGTGATTCTGCTACTGCGACTTAAGCTTTCCTCTGTACATAAATTGGGAGGAGCTGTTGCACCGCACGGGCTCTGGCCAATTGAAGGGTTCAGAAGGGTTCATCACTGGCGCAGGCAACGTGCCGCCCATTTTAATGTGTTAGAACTGCTCTACTACAGTGTAGGCGAAAGCTTGCATCAGTGCGATTGTAT

Full Affymetrix probeset data:

Annotations for 1626215_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720