FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626216_at:

>probe:Drosophila_2:1626216_at:539:285; Interrogation_Position=107; Antisense; CGGCGCAATCGTATGTGCATTCGCA
>probe:Drosophila_2:1626216_at:696:617; Interrogation_Position=122; Antisense; TGCATTCGCATAGCTCACTGTACTG
>probe:Drosophila_2:1626216_at:537:147; Interrogation_Position=161; Antisense; ACTACCATTTTATGCGGCTAGCCGG
>probe:Drosophila_2:1626216_at:70:289; Interrogation_Position=192; Antisense; CGGCGCATCGGCCATTTTTATGAGT
>probe:Drosophila_2:1626216_at:426:87; Interrogation_Position=214; Antisense; AGTGCCTACTGCAAGTATGTGCTGC
>probe:Drosophila_2:1626216_at:232:649; Interrogation_Position=254; Antisense; TCAGGGAGCAACTGGACTCGCAGGC
>probe:Drosophila_2:1626216_at:152:73; Interrogation_Position=275; Antisense; AGGCATTCGCCGATGTGGCCAATCG
>probe:Drosophila_2:1626216_at:110:201; Interrogation_Position=31; Antisense; AACGCCGTCTTGGAGAGCATCGGAC
>probe:Drosophila_2:1626216_at:428:683; Interrogation_Position=349; Antisense; TATCCATTCCTTACAGGCACGCTGA
>probe:Drosophila_2:1626216_at:632:147; Interrogation_Position=410; Antisense; ACTATCGCGCCCTAACGGGTGAGAA
>probe:Drosophila_2:1626216_at:107:67; Interrogation_Position=435; Antisense; ATGGATGCAGCCGTATGCCACAATG
>probe:Drosophila_2:1626216_at:246:49; Interrogation_Position=449; Antisense; ATGCCACAATGGGAGGATTCTGCCT
>probe:Drosophila_2:1626216_at:512:299; Interrogation_Position=480; Antisense; CGCCTGGCTATCGTTGGTGCTGTAG
>probe:Drosophila_2:1626216_at:75:547; Interrogation_Position=78; Antisense; GGATGATTCCATCGTGTCACTGCCT

Paste this into a BLAST search page for me
CGGCGCAATCGTATGTGCATTCGCATGCATTCGCATAGCTCACTGTACTGACTACCATTTTATGCGGCTAGCCGGCGGCGCATCGGCCATTTTTATGAGTAGTGCCTACTGCAAGTATGTGCTGCTCAGGGAGCAACTGGACTCGCAGGCAGGCATTCGCCGATGTGGCCAATCGAACGCCGTCTTGGAGAGCATCGGACTATCCATTCCTTACAGGCACGCTGAACTATCGCGCCCTAACGGGTGAGAAATGGATGCAGCCGTATGCCACAATGATGCCACAATGGGAGGATTCTGCCTCGCCTGGCTATCGTTGGTGCTGTAGGGATGATTCCATCGTGTCACTGCCT

Full Affymetrix probeset data:

Annotations for 1626216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720