FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626217_at:

>probe:Drosophila_2:1626217_at:238:305; Interrogation_Position=1016; Antisense; CCGGTGCTGGACATAAGGCCTTGAA
>probe:Drosophila_2:1626217_at:283:1; Interrogation_Position=1031; Antisense; AGGCCTTGAAGGTGATTACCCACGA
>probe:Drosophila_2:1626217_at:416:81; Interrogation_Position=1055; Antisense; AGGTGGATGTGTATCTGCTTAGCAA
>probe:Drosophila_2:1626217_at:190:169; Interrogation_Position=1078; Antisense; AAAGGCTCCACCTTCAAGTGGGACA
>probe:Drosophila_2:1626217_at:615:221; Interrogation_Position=1093; Antisense; AAGTGGGACACGTGTGCTCCGCAAG
>probe:Drosophila_2:1626217_at:21:569; Interrogation_Position=1179; Antisense; GGCAGTGCCATTGAAGTACCTGATT
>probe:Drosophila_2:1626217_at:489:203; Interrogation_Position=1214; Antisense; AAGCCGATGCCGATTGGAAGCGAAA
>probe:Drosophila_2:1626217_at:329:533; Interrogation_Position=1243; Antisense; GGTGGTATAATCTCTGTGCGCAATG
>probe:Drosophila_2:1626217_at:648:535; Interrogation_Position=888; Antisense; GGTAAGGGCACACAACTGCGACTTT
>probe:Drosophila_2:1626217_at:263:195; Interrogation_Position=901; Antisense; AACTGCGACTTTGAGGCGCGCGATG
>probe:Drosophila_2:1626217_at:359:57; Interrogation_Position=923; Antisense; ATGAGAACCGCCGTTTGGGCATCTT
>probe:Drosophila_2:1626217_at:317:189; Interrogation_Position=959; Antisense; AACAGTCCGATATCCTTCAGCGTTT
>probe:Drosophila_2:1626217_at:596:707; Interrogation_Position=974; Antisense; TTCAGCGTTTCCTCGATCTGGGCTA
>probe:Drosophila_2:1626217_at:44:453; Interrogation_Position=988; Antisense; GATCTGGGCTACGAGTTTGCATTCT

Paste this into a BLAST search page for me
CCGGTGCTGGACATAAGGCCTTGAAAGGCCTTGAAGGTGATTACCCACGAAGGTGGATGTGTATCTGCTTAGCAAAAAGGCTCCACCTTCAAGTGGGACAAAGTGGGACACGTGTGCTCCGCAAGGGCAGTGCCATTGAAGTACCTGATTAAGCCGATGCCGATTGGAAGCGAAAGGTGGTATAATCTCTGTGCGCAATGGGTAAGGGCACACAACTGCGACTTTAACTGCGACTTTGAGGCGCGCGATGATGAGAACCGCCGTTTGGGCATCTTAACAGTCCGATATCCTTCAGCGTTTTTCAGCGTTTCCTCGATCTGGGCTAGATCTGGGCTACGAGTTTGCATTCT

Full Affymetrix probeset data:

Annotations for 1626217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720