Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626220_at:

>probe:Drosophila_2:1626220_at:133:591; Interrogation_Position=447; Antisense; TGGTCAGCAGAAGCCACAAGCAGCT
>probe:Drosophila_2:1626220_at:349:201; Interrogation_Position=498; Antisense; AACCGCATCCCTGGCTGAATATGAA
>probe:Drosophila_2:1626220_at:144:397; Interrogation_Position=567; Antisense; GAAATTCCTGCTGCTTTTGAACAGC
>probe:Drosophila_2:1626220_at:317:385; Interrogation_Position=585; Antisense; GAACAGCAAAAAGGCCCACATCCGG
>probe:Drosophila_2:1626220_at:472:257; Interrogation_Position=601; Antisense; CACATCCGGGATTTAGAGAGTCAGT
>probe:Drosophila_2:1626220_at:236:199; Interrogation_Position=632; Antisense; AACGATCCGGGAAAGTATCAAGAGC
>probe:Drosophila_2:1626220_at:338:541; Interrogation_Position=671; Antisense; GGATTTTTTCTGATGACGAGGACGA
>probe:Drosophila_2:1626220_at:609:437; Interrogation_Position=688; Antisense; GAGGACGATGCCTACGGAGCAGCTA
>probe:Drosophila_2:1626220_at:91:35; Interrogation_Position=695; Antisense; ATGCCTACGGAGCAGCTACTCAAGT
>probe:Drosophila_2:1626220_at:32:195; Interrogation_Position=733; Antisense; AACGACTCAGATTAAGCCCCTTAGT
>probe:Drosophila_2:1626220_at:469:409; Interrogation_Position=778; Antisense; GACGAAATCGGTATGTGCTTGAAAT
>probe:Drosophila_2:1626220_at:534:671; Interrogation_Position=911; Antisense; TACCATCAATGTGTAGACGTGGCTT
>probe:Drosophila_2:1626220_at:55:407; Interrogation_Position=926; Antisense; GACGTGGCTTACAATTAGACCAACA
>probe:Drosophila_2:1626220_at:594:241; Interrogation_Position=981; Antisense; AATAGTTATCGTTGCTGTTTTTGTA

Paste this into a BLAST search page for me
TGGTCAGCAGAAGCCACAAGCAGCTAACCGCATCCCTGGCTGAATATGAAGAAATTCCTGCTGCTTTTGAACAGCGAACAGCAAAAAGGCCCACATCCGGCACATCCGGGATTTAGAGAGTCAGTAACGATCCGGGAAAGTATCAAGAGCGGATTTTTTCTGATGACGAGGACGAGAGGACGATGCCTACGGAGCAGCTAATGCCTACGGAGCAGCTACTCAAGTAACGACTCAGATTAAGCCCCTTAGTGACGAAATCGGTATGTGCTTGAAATTACCATCAATGTGTAGACGTGGCTTGACGTGGCTTACAATTAGACCAACAAATAGTTATCGTTGCTGTTTTTGTA

Full Affymetrix probeset data:

Annotations for 1626220_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime