Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626223_at:

>probe:Drosophila_2:1626223_at:650:715; Interrogation_Position=1489; Antisense; TTCTGATCTTTAATCGCACCGGAGA
>probe:Drosophila_2:1626223_at:510:479; Interrogation_Position=1519; Antisense; GTTTCGCACCTCTGCTAAAGCTACT
>probe:Drosophila_2:1626223_at:8:201; Interrogation_Position=1545; Antisense; AACCGCACCTGTGACTTTGACATGG
>probe:Drosophila_2:1626223_at:598:723; Interrogation_Position=1561; Antisense; TTGACATGGTCTGCTTTGTGCCCAA
>probe:Drosophila_2:1626223_at:301:299; Interrogation_Position=1611; Antisense; CCCAGCCAGGTGATGGTTCGTTTTA
>probe:Drosophila_2:1626223_at:568:545; Interrogation_Position=1663; Antisense; GGATCATTGCCTCAGCTTGGAGTGA
>probe:Drosophila_2:1626223_at:528:511; Interrogation_Position=1684; Antisense; GTGACCTCTGCGCAACGGAGCAAAA
>probe:Drosophila_2:1626223_at:432:489; Interrogation_Position=1725; Antisense; GTGTATAATACGCTAACCGACGCTT
>probe:Drosophila_2:1626223_at:366:411; Interrogation_Position=1743; Antisense; GACGCTTTTACTGCCATCAGGCAAA
>probe:Drosophila_2:1626223_at:336:95; Interrogation_Position=1767; Antisense; AGATTTCCACAAGCCACAGACAATG
>probe:Drosophila_2:1626223_at:711:541; Interrogation_Position=1818; Antisense; GGTTCCATTCATCTGCTGGGAGCAG
>probe:Drosophila_2:1626223_at:608:333; Interrogation_Position=1832; Antisense; GCTGGGAGCAGCTATAAGTGCCCTA
>probe:Drosophila_2:1626223_at:532:219; Interrogation_Position=1847; Antisense; AAGTGCCCTAGATCTTATCGATGAT
>probe:Drosophila_2:1626223_at:590:359; Interrogation_Position=1972; Antisense; GCAAGCCACTTGCATATCACTTAGT

Paste this into a BLAST search page for me
TTCTGATCTTTAATCGCACCGGAGAGTTTCGCACCTCTGCTAAAGCTACTAACCGCACCTGTGACTTTGACATGGTTGACATGGTCTGCTTTGTGCCCAACCCAGCCAGGTGATGGTTCGTTTTAGGATCATTGCCTCAGCTTGGAGTGAGTGACCTCTGCGCAACGGAGCAAAAGTGTATAATACGCTAACCGACGCTTGACGCTTTTACTGCCATCAGGCAAAAGATTTCCACAAGCCACAGACAATGGGTTCCATTCATCTGCTGGGAGCAGGCTGGGAGCAGCTATAAGTGCCCTAAAGTGCCCTAGATCTTATCGATGATGCAAGCCACTTGCATATCACTTAGT

Full Affymetrix probeset data:

Annotations for 1626223_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime