Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626227_at:

>probe:Drosophila_2:1626227_at:673:133; Interrogation_Position=2347; Antisense; ACCCTGAGTGGCCTGTGCAAGCGTT
>probe:Drosophila_2:1626227_at:334:557; Interrogation_Position=2388; Antisense; GGACTCCGAGCATCGACCGGCGCTG
>probe:Drosophila_2:1626227_at:395:623; Interrogation_Position=2416; Antisense; TGCGTGGGCCACAGTGATGACGAAA
>probe:Drosophila_2:1626227_at:306:431; Interrogation_Position=2431; Antisense; GATGACGAAAAGTGCTCGCTTTCTA
>probe:Drosophila_2:1626227_at:103:509; Interrogation_Position=2442; Antisense; GTGCTCGCTTTCTATTGACTAGTTA
>probe:Drosophila_2:1626227_at:606:361; Interrogation_Position=2493; Antisense; GCAATAACTATTGTTGGCGACTGAT
>probe:Drosophila_2:1626227_at:441:575; Interrogation_Position=2508; Antisense; GGCGACTGATATAATTCGTCATTAA
>probe:Drosophila_2:1626227_at:599:355; Interrogation_Position=2546; Antisense; GCACATGTATTATGCTTTGGAATTA
>probe:Drosophila_2:1626227_at:500:565; Interrogation_Position=2564; Antisense; GGAATTATTAGTTTGCTGCCCTGCT
>probe:Drosophila_2:1626227_at:566:321; Interrogation_Position=2581; Antisense; GCCCTGCTTGGCTCTCTAAATGAAT
>probe:Drosophila_2:1626227_at:331:613; Interrogation_Position=2601; Antisense; TGAATTTAGCCATTTACTACGTTTA
>probe:Drosophila_2:1626227_at:522:299; Interrogation_Position=2628; Antisense; CGCCCCGCTTTATTTGCAATTGATA
>probe:Drosophila_2:1626227_at:687:473; Interrogation_Position=2662; Antisense; GTTACAGATTGGTCGTCTTATTTGC
>probe:Drosophila_2:1626227_at:126:499; Interrogation_Position=2676; Antisense; GTCTTATTTGCGAATTTTTTATCCA

Paste this into a BLAST search page for me
ACCCTGAGTGGCCTGTGCAAGCGTTGGACTCCGAGCATCGACCGGCGCTGTGCGTGGGCCACAGTGATGACGAAAGATGACGAAAAGTGCTCGCTTTCTAGTGCTCGCTTTCTATTGACTAGTTAGCAATAACTATTGTTGGCGACTGATGGCGACTGATATAATTCGTCATTAAGCACATGTATTATGCTTTGGAATTAGGAATTATTAGTTTGCTGCCCTGCTGCCCTGCTTGGCTCTCTAAATGAATTGAATTTAGCCATTTACTACGTTTACGCCCCGCTTTATTTGCAATTGATAGTTACAGATTGGTCGTCTTATTTGCGTCTTATTTGCGAATTTTTTATCCA

Full Affymetrix probeset data:

Annotations for 1626227_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime